ID: 1035746225

View in Genome Browser
Species Human (GRCh38)
Location 8:1963579-1963601
Sequence TGGCCATGTGCCATCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746225_1035746234 20 Left 1035746225 8:1963579-1963601 CCTGTGTAGATGGCACATGGCCA No data
Right 1035746234 8:1963622-1963644 TCCAAGGATAAAGAAGAGACGGG No data
1035746225_1035746236 21 Left 1035746225 8:1963579-1963601 CCTGTGTAGATGGCACATGGCCA No data
Right 1035746236 8:1963623-1963645 CCAAGGATAAAGAAGAGACGGGG No data
1035746225_1035746230 4 Left 1035746225 8:1963579-1963601 CCTGTGTAGATGGCACATGGCCA No data
Right 1035746230 8:1963606-1963628 TGGCAGAACCGCCTTTTCCAAGG No data
1035746225_1035746233 19 Left 1035746225 8:1963579-1963601 CCTGTGTAGATGGCACATGGCCA No data
Right 1035746233 8:1963621-1963643 TTCCAAGGATAAAGAAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746225 Original CRISPR TGGCCATGTGCCATCTACAC AGG (reversed) Intergenic
No off target data available for this crispr