ID: 1035746228

View in Genome Browser
Species Human (GRCh38)
Location 8:1963586-1963608
Sequence AGATGGCACATGGCCAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746217_1035746228 21 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746228 8:1963586-1963608 AGATGGCACATGGCCAAGGGTGG No data
1035746221_1035746228 2 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746228 8:1963586-1963608 AGATGGCACATGGCCAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746228 Original CRISPR AGATGGCACATGGCCAAGGG TGG Intergenic
No off target data available for this crispr