ID: 1035746230

View in Genome Browser
Species Human (GRCh38)
Location 8:1963606-1963628
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746225_1035746230 4 Left 1035746225 8:1963579-1963601 CCTGTGTAGATGGCACATGGCCA No data
Right 1035746230 8:1963606-1963628 TGGCAGAACCGCCTTTTCCAAGG No data
1035746221_1035746230 22 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746230 8:1963606-1963628 TGGCAGAACCGCCTTTTCCAAGG No data
1035746224_1035746230 5 Left 1035746224 8:1963578-1963600 CCCTGTGTAGATGGCACATGGCC No data
Right 1035746230 8:1963606-1963628 TGGCAGAACCGCCTTTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746230 Original CRISPR TGGCAGAACCGCCTTTTCCA AGG Intergenic