ID: 1035746234

View in Genome Browser
Species Human (GRCh38)
Location 8:1963622-1963644
Sequence TCCAAGGATAAAGAAGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746224_1035746234 21 Left 1035746224 8:1963578-1963600 CCCTGTGTAGATGGCACATGGCC No data
Right 1035746234 8:1963622-1963644 TCCAAGGATAAAGAAGAGACGGG No data
1035746229_1035746234 0 Left 1035746229 8:1963599-1963621 CCAAGGGTGGCAGAACCGCCTTT No data
Right 1035746234 8:1963622-1963644 TCCAAGGATAAAGAAGAGACGGG No data
1035746225_1035746234 20 Left 1035746225 8:1963579-1963601 CCTGTGTAGATGGCACATGGCCA No data
Right 1035746234 8:1963622-1963644 TCCAAGGATAAAGAAGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746234 Original CRISPR TCCAAGGATAAAGAAGAGAC GGG Intergenic
No off target data available for this crispr