ID: 1035746980

View in Genome Browser
Species Human (GRCh38)
Location 8:1968122-1968144
Sequence GCATCCTCTTGAACTTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746980_1035746984 2 Left 1035746980 8:1968122-1968144 CCCAGACAAGTTCAAGAGGATGC No data
Right 1035746984 8:1968147-1968169 GCTGGGACATTTACACTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746980 Original CRISPR GCATCCTCTTGAACTTGTCT GGG (reversed) Intergenic
No off target data available for this crispr