ID: 1035746984

View in Genome Browser
Species Human (GRCh38)
Location 8:1968147-1968169
Sequence GCTGGGACATTTACACTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746978_1035746984 15 Left 1035746978 8:1968109-1968131 CCATCTCGGGCGACCCAGACAAG No data
Right 1035746984 8:1968147-1968169 GCTGGGACATTTACACTCTAAGG No data
1035746980_1035746984 2 Left 1035746980 8:1968122-1968144 CCCAGACAAGTTCAAGAGGATGC No data
Right 1035746984 8:1968147-1968169 GCTGGGACATTTACACTCTAAGG No data
1035746981_1035746984 1 Left 1035746981 8:1968123-1968145 CCAGACAAGTTCAAGAGGATGCA No data
Right 1035746984 8:1968147-1968169 GCTGGGACATTTACACTCTAAGG No data
1035746977_1035746984 19 Left 1035746977 8:1968105-1968127 CCTGCCATCTCGGGCGACCCAGA No data
Right 1035746984 8:1968147-1968169 GCTGGGACATTTACACTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746984 Original CRISPR GCTGGGACATTTACACTCTA AGG Intergenic