ID: 1035749004

View in Genome Browser
Species Human (GRCh38)
Location 8:1982514-1982536
Sequence GTGTTTCCTCAAAGGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035749004_1035749009 -6 Left 1035749004 8:1982514-1982536 CCCACTGGCCTTTGAGGAAACAC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035749009 8:1982531-1982553 AAACACAGGTTGAGAGTGAAGGG No data
1035749004_1035749010 -2 Left 1035749004 8:1982514-1982536 CCCACTGGCCTTTGAGGAAACAC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035749010 8:1982535-1982557 ACAGGTTGAGAGTGAAGGGATGG No data
1035749004_1035749011 -1 Left 1035749004 8:1982514-1982536 CCCACTGGCCTTTGAGGAAACAC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035749011 8:1982536-1982558 CAGGTTGAGAGTGAAGGGATGGG No data
1035749004_1035749008 -7 Left 1035749004 8:1982514-1982536 CCCACTGGCCTTTGAGGAAACAC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1035749008 8:1982530-1982552 GAAACACAGGTTGAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035749004 Original CRISPR GTGTTTCCTCAAAGGCCAGT GGG (reversed) Intronic
900628760 1:3622754-3622776 GTGTTTCCTCATAGCCCTGGAGG - Intergenic
901439790 1:9270872-9270894 TTGTTTCCACAAAAACCAGTGGG - Exonic
903305138 1:22408037-22408059 GTGGAACCTCAAAGTCCAGTTGG + Intergenic
906048579 1:42852124-42852146 GTACTTCCTCAAAGGCCAGGGGG - Exonic
907641802 1:56198004-56198026 GTGTTTCCTCATAGCCCCTTTGG - Intergenic
908762981 1:67529258-67529280 GTGTTTCTACAAAGACAAGTGGG + Intergenic
908825752 1:68131370-68131392 GTGTTTTCCTAAATGCCAGTGGG - Intronic
910212009 1:84803279-84803301 GTCTGTCTTCAATGGCCAGTTGG - Intergenic
915199145 1:154213602-154213624 GTTTTTCCACAAAGGACAGGTGG - Intronic
915283781 1:154840085-154840107 GTATTTCCTAAAAGGTCACTGGG + Intronic
915832153 1:159141200-159141222 GTGTTACCTCAGAGGACAGTTGG + Intronic
917792611 1:178508926-178508948 GTGTCACCTGAATGGCCAGTGGG - Intergenic
920007203 1:202842099-202842121 GTGTTTCCTCTAAAGGCACTAGG + Intergenic
920765573 1:208830168-208830190 TTGTTTCCTGGAAAGCCAGTTGG + Intergenic
921778526 1:219131989-219132011 TTGTTTCCTAAGAGCCCAGTGGG - Intergenic
924532716 1:244906899-244906921 GTGCTTGCTCATTGGCCAGTTGG - Intergenic
924536398 1:244939541-244939563 GTGCTTCCACAAAGACCACTCGG - Intergenic
1067929795 10:50549135-50549157 GTGATTCCTCAAAGACCAAGAGG + Intronic
1068037658 10:51781379-51781401 CTGTTTCCCCAAAGGCAAGAGGG + Intronic
1071131110 10:82394527-82394549 GTGGTTCCTCAAACACCACTTGG + Intronic
1071924947 10:90395443-90395465 CTGTTTCCTCACATGGCAGTGGG + Intergenic
1072268450 10:93752675-93752697 GTGGTTCCACAAAAGCAAGTTGG - Intergenic
1074144400 10:110703737-110703759 GTGTTTCGTCAAAGGGCGGGAGG - Intronic
1075468695 10:122671686-122671708 GCATTTCCCCAAAGTCCAGTGGG - Intergenic
1075562674 10:123479835-123479857 GTGTTTCCCCAAATGCTTGTGGG + Intergenic
1075699620 10:124460932-124460954 GAGTTTCCTCAATGGCCCCTCGG - Intergenic
1076077877 10:127551269-127551291 TTTTTTCCCCAGAGGCCAGTGGG + Intronic
1085491183 11:76919278-76919300 GTGTTTTCTCATAGGACAGTAGG - Intronic
1087415635 11:97851921-97851943 GTTTTTCCTCAAATGTCAGGAGG + Intergenic
1089677448 11:120099278-120099300 GTGGCTGCTCTAAGGCCAGTGGG + Intergenic
1090272852 11:125400013-125400035 GTCTTTCCTCAAAGCTCAGAAGG - Intronic
1092145835 12:6214035-6214057 GTGCTTCCTCACTGGCCAGGGGG - Intronic
1094826677 12:34274976-34274998 GTGGTTCCTCAAGGGGCTGTGGG - Intergenic
1095782559 12:46076052-46076074 GTGATGCCTAAAAGGCCATTGGG + Intergenic
1095975324 12:47937092-47937114 ATGTTACCACAAAGGCCAGGCGG + Intronic
1096707282 12:53430165-53430187 GTTCTGCCTCATAGGCCAGTTGG - Exonic
1100329240 12:93570018-93570040 GAGTTTCCACTAAGGCCAGGGGG + Intronic
1100349645 12:93767369-93767391 GTGTTTCCTCAGTTGCCAGTAGG + Intronic
1104550052 12:129748393-129748415 GTGTGTCCTCAAAGCCCATTTGG - Intronic
1105679367 13:22709900-22709922 GTATTTCCTCAAAGCTAAGTTGG - Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108270220 13:48751983-48752005 GGGTTTCCTCAAGAGCCTGTGGG + Intergenic
1109104657 13:58235894-58235916 GGGTTTCCTTGAAGGTCAGTTGG - Intergenic
1109771222 13:66976101-66976123 TTTTTTCCTCAAAGGACAGAGGG - Intronic
1111424906 13:88067995-88068017 GTGTTCCCTGAAAACCCAGTGGG + Intergenic
1111642201 13:90982680-90982702 GTGATTCCTCAAAGACCTGGAGG + Intergenic
1113607295 13:111618773-111618795 CTGTTTCCTCAAAGGCCAAGGGG + Intronic
1113653041 13:112050816-112050838 CTGTTCCCACAAAGGGCAGTTGG + Intergenic
1114910052 14:27181046-27181068 GTGTTTTCTGAAAGCCAAGTAGG - Intergenic
1115885272 14:37964445-37964467 GTGATTCCTCAAAGACCAAATGG - Intronic
1117080537 14:52147640-52147662 GTGATTCCTCAAAGGCCTAGAGG + Intergenic
1118051820 14:62037648-62037670 GTGTTTCCTCAGACTCCACTGGG + Intronic
1120328568 14:83058436-83058458 ATGTTTCCTCAATGACCTGTGGG - Intergenic
1120839980 14:89077040-89077062 GTGATTCCTCAAAGACCTGGAGG - Intergenic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1124584958 15:30996387-30996409 TTGTTTCTTCAAGGCCCAGTAGG - Intergenic
1125296978 15:38213804-38213826 GTGTTTCTCCAAAGTCCTGTGGG - Intergenic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1127397456 15:58553924-58553946 GTGTTTTCTCCAAGCCCAGAGGG - Intronic
1133729828 16:8569671-8569693 CTTCTTCCTCAAAGGCCACTCGG - Exonic
1135958129 16:26973449-26973471 GTGTTTCAAGAAAGGCCAGATGG - Intergenic
1136018631 16:27425184-27425206 GTGTTTCCTACAAGGACAGAAGG - Intronic
1136097024 16:27964038-27964060 TTGTTTCCTCAAAGGCTAGAGGG + Intronic
1141425257 16:83940671-83940693 GCGTGTCCTCAGAGGACAGTGGG + Intronic
1141467812 16:84218491-84218513 TTGTTTTCTCTGAGGCCAGTGGG - Intergenic
1142373828 16:89696891-89696913 GAGTGTCCTCAAGGGCCTGTTGG - Exonic
1144121318 17:12156362-12156384 GTGATTCCTCAAAGACCTGGAGG + Intergenic
1145939991 17:28738169-28738191 GCGTTTCCTGGAGGGCCAGTCGG + Exonic
1149294427 17:55249103-55249125 GTGTTTAATGAAAGCCCAGTTGG - Intergenic
1150863080 17:68821388-68821410 TTGTCTCTTCAAAGGCAAGTAGG + Intergenic
1156509246 18:37621745-37621767 TTGTTTGCACAAAGGGCAGTAGG + Intergenic
1162366963 19:10255565-10255587 GTGTTGCCACAGAGGCCAGTGGG + Intronic
1163466094 19:17469509-17469531 GTGTTTCCTAAAAGGAGAGGGGG + Intronic
1164617691 19:29676680-29676702 GTCCTTCCTGGAAGGCCAGTGGG - Intergenic
924974191 2:157887-157909 GTGATTCCCCACAGGCCAGCAGG - Intergenic
925323014 2:2991458-2991480 CTATTTCCTCAAAGGCAAATTGG + Intergenic
925887904 2:8409492-8409514 GTGTTTCCCCAAATGCCACCAGG - Intergenic
930525890 2:52529347-52529369 GTGATTCCTCAAAGACCTATAGG + Intergenic
931083950 2:58808051-58808073 AAGTTTCCTCACAGGCCGGTGGG - Intergenic
932171418 2:69560492-69560514 GTGTTTCAAAAAATGCCAGTAGG - Intronic
933935157 2:87197780-87197802 GTGCTTCCTGGATGGCCAGTGGG + Intergenic
934756006 2:96825260-96825282 ATGTTGCGTCAGAGGCCAGTGGG + Intronic
936357988 2:111768118-111768140 GTGCTTCCTGGATGGCCAGTGGG - Exonic
937637263 2:124170264-124170286 GTTTTTCCTGAAAGGGCATTGGG + Intronic
938040191 2:128069378-128069400 TTGTTTCCTGAAAGGGCCGTAGG + Intergenic
939553264 2:143642353-143642375 CTGTTTCCACAAAGGTGAGTTGG - Intronic
939870973 2:147525510-147525532 TTGAATCCTCAAAGACCAGTGGG - Intergenic
939882683 2:147648060-147648082 GTTTTTCGTCAAAGGCCTGCAGG + Intergenic
941489817 2:166129480-166129502 GTGCTTTCCCAAAAGCCAGTTGG + Intergenic
948726347 2:239936340-239936362 GTGTCTCCTTAAAGGTAAGTGGG + Intronic
1172451554 20:35028513-35028535 GTATGTCCTCAAATCCCAGTGGG - Intronic
1180956908 22:19745308-19745330 GTGTGTCCTCACAGGACAGCTGG - Intergenic
1181681352 22:24497842-24497864 CTGTTTCCCCAAAGGTCTGTGGG + Intronic
1181864018 22:25841100-25841122 GTGTTCCCACAAGGGCCAGCAGG + Intronic
1185104298 22:48858457-48858479 GGGTTTCCTCAGAGTCCTGTTGG - Intergenic
1185330238 22:50249096-50249118 CAGTCACCTCAAAGGCCAGTGGG + Exonic
950979977 3:17292152-17292174 GTGTTCCTTCAAAGGCAATTTGG - Intronic
952616851 3:35283837-35283859 GTGATTCCTCAAAGACCTATAGG + Intergenic
955075465 3:55609208-55609230 GTGTTGCCTCAAAGGGAAATTGG - Intronic
958629844 3:96671200-96671222 ATGATTCCTCAAAGGCCAGCAGG - Intergenic
958972727 3:100630561-100630583 GAAGTTCCTCACAGGCCAGTGGG + Intronic
961127238 3:124430760-124430782 GTGTTACCTCGATGGCCAGTTGG - Exonic
962046428 3:131764831-131764853 GTTTTTCCTCATAAGCCTGTTGG - Intronic
965296267 3:166950848-166950870 TTGTTTCGTCAAAGATCAGTTGG + Intergenic
967222775 3:187262056-187262078 TTGTTTCCTCTAAGGGAAGTGGG + Intronic
967556986 3:190871635-190871657 GTGTTCCATCAAAGGCCAGATGG + Intronic
968489363 4:881815-881837 GTGTCTCCTGGAGGGCCAGTCGG - Intronic
976086747 4:81414626-81414648 TTGTTTTGTCAAAGACCAGTTGG - Intergenic
977020372 4:91751473-91751495 GTGATTCTTCAGAGGCCAGGTGG + Intergenic
980168408 4:129255880-129255902 ATGTTGTCTCAAAGGCCATTAGG - Intergenic
980368110 4:131832506-131832528 GTGATTCCTGAAACCCCAGTGGG + Intergenic
987220867 5:15789429-15789451 GGGTTGCCTCAAAGGGCAGGTGG - Intronic
988265336 5:28942036-28942058 GTGTTTATTCAAGGCCCAGTGGG + Intergenic
989566408 5:42905587-42905609 GTGTGTCCTCAAAGACAACTTGG - Intergenic
990480072 5:56201734-56201756 GTGATTCCTCAAAGACCAAGAGG + Intronic
990888993 5:60628404-60628426 GAGTTCCCTGAAAGGCCAATGGG + Intronic
991201887 5:64004287-64004309 CTGTGTCCTCCAAGGACAGTAGG - Intergenic
993020689 5:82586839-82586861 CTGTTCTCTCAAAGGCCTGTTGG + Intergenic
994308748 5:98240518-98240540 GTGTCTATTCAAAAGCCAGTAGG - Intergenic
994332079 5:98518254-98518276 GTGTTGCTTTAAAGCCCAGTTGG - Intergenic
996602158 5:125277009-125277031 AAGTTGCCTCAAAGGCCAGAAGG + Intergenic
999614500 5:153407626-153407648 ATGTTTCCTCAAAGGGCATTTGG + Intergenic
1000251484 5:159499855-159499877 GTGTTTCATGAAGGGCAAGTGGG - Intergenic
1001084922 5:168693569-168693591 GGGTTTCCTCAAATTCCACTAGG + Intronic
1001522651 5:172405735-172405757 GTGTTACCTCACAGGTCTGTGGG - Intronic
1001857513 5:175025657-175025679 GTCATTCCCCAAAGGCCAGTAGG - Intergenic
1002553284 5:180014297-180014319 CTGTTTCCTTAAAAGACAGTGGG - Intronic
1003787707 6:9505631-9505653 GTGTTTCCTCAAAGACAATGTGG + Intergenic
1008430768 6:51414096-51414118 GTGTGTCTTCAAAGTACAGTTGG - Intergenic
1010136595 6:72561472-72561494 GGATGTCCTCAAATGCCAGTGGG - Intergenic
1012707037 6:102544944-102544966 GTGTTTCCTTTAGGGCCAGAGGG - Intergenic
1014271951 6:119346389-119346411 GTGTTTAGTCAAAGGCTAATGGG - Intronic
1017444229 6:154492904-154492926 GGGTATTCTGAAAGGCCAGTAGG - Intronic
1018098451 6:160414644-160414666 GTGTTTCCTCACATGGCAGCAGG + Intronic
1021488669 7:21194500-21194522 GAGTTTCCCCAAATGCCATTAGG + Intergenic
1024464692 7:49700046-49700068 GTCTTTCCCCAAAGGGCAGCAGG + Intergenic
1026283881 7:68946079-68946101 GCGATTCCTCAAAGGCCTGGAGG + Intergenic
1030053453 7:105560354-105560376 GTGTTTCCCCAAAGGAAAATTGG + Intronic
1030655426 7:112162339-112162361 GTGTTTCCTCTGAGGCAAGGGGG - Intronic
1031885997 7:127246717-127246739 CTGTTTCCTAAAAGGCCAGAAGG + Intronic
1032985081 7:137328746-137328768 TTGTTTTCTCAAACACCAGTTGG - Intronic
1033565402 7:142573962-142573984 GTGATTCCTCAAAGGCCTAGAGG + Intergenic
1035749004 8:1982514-1982536 GTGTTTCCTCAAAGGCCAGTGGG - Intronic
1037862180 8:22413259-22413281 GTGTTTTCTGAAATGTCAGTTGG + Intronic
1037921789 8:22811746-22811768 TGGTTTCCTCAAAAGCCAGCTGG + Intronic
1039432593 8:37536688-37536710 ATGTTTCCTCAAAAGACAGAAGG + Intergenic
1041877569 8:62708008-62708030 TTGTTTTGTCAAAGACCAGTTGG + Intronic
1042646828 8:70996696-70996718 CTGTTTCCTCAAATGCCAAGGGG - Intergenic
1045381617 8:101633327-101633349 ATGTTTCCTCAAAGGACTTTGGG - Intronic
1051105444 9:13574145-13574167 TTGTTTTGTCAAAGACCAGTTGG + Intergenic
1051349636 9:16186752-16186774 CTGTCTCCTCAAAGGCCTGTTGG - Intergenic
1051914662 9:22193817-22193839 GTGATTCCTCAAAGACCTGGAGG - Intergenic
1052711688 9:32064546-32064568 GTGTTTTGTCAAAGTTCAGTTGG - Intergenic
1053163433 9:35829123-35829145 GTGTGTCCTCGAAGCCCAGCAGG + Intronic
1053227744 9:36375526-36375548 CTGTATCCTCAAAGGCAATTAGG - Intronic
1058377609 9:104341634-104341656 CTGTTTCCTCACAGGGCAGAAGG - Intergenic
1061283804 9:129611223-129611245 CTGTTTCCTCAGCGGCCAGGAGG + Intronic
1062012616 9:134275155-134275177 GTGTCTCCTCAGAGGCCACCAGG - Intergenic
1186295032 X:8140180-8140202 GTCTTTCCTAAAAACCCAGTTGG + Intergenic
1188176558 X:26997950-26997972 TTGTTTTGTCAAAGGTCAGTTGG - Intergenic
1188522836 X:31057901-31057923 GGGTTTCCTCAAATGCTGGTGGG - Intergenic
1192226870 X:69234925-69234947 CTGTTTCCTCTAAGGCCTATTGG - Intergenic
1192639633 X:72849558-72849580 GTGTTTCCTCATAGGCAAAATGG - Intergenic
1192642078 X:72871247-72871269 GTGTTTCCTCATAGGCAAAATGG + Intergenic
1195509279 X:105695944-105695966 ATGTTTCATCTAAGGCCAGGAGG + Intronic