ID: 1035749610

View in Genome Browser
Species Human (GRCh38)
Location 8:1987167-1987189
Sequence GTGTAAAAACAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 679}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035749610_1035749612 -5 Left 1035749610 8:1987167-1987189 CCTTCCTCTCTCTGTTTTTACAC 0: 1
1: 0
2: 2
3: 66
4: 679
Right 1035749612 8:1987185-1987207 TACACTTCCATAAAAGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035749610 Original CRISPR GTGTAAAAACAGAGAGAGGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901240275 1:7688903-7688925 GGGGAAAAACAGTGAGAGGCAGG + Intronic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
902072629 1:13753767-13753789 GTTTCAGAAGAGAGAGAGGAAGG + Intronic
903192922 1:21666904-21666926 GTGTACACACAGAGAGACGGAGG - Intronic
903286183 1:22278179-22278201 GAGATAAAAGAGAGAGAGGAAGG + Intergenic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904455481 1:30645471-30645493 GTGGAAAGGGAGAGAGAGGAAGG - Intergenic
904610228 1:31721784-31721806 GTGAAAAAAAAGAGAAAAGAGGG - Intergenic
905110793 1:35593009-35593031 AAGAAAAGACAGAGAGAGGAGGG + Intronic
905313580 1:37066894-37066916 ATGTCAAAACAAAGGGAGGAAGG - Intergenic
905352795 1:37359153-37359175 GAGGAGAAACAGAGAGAGGTTGG + Intergenic
905383413 1:37581071-37581093 AAGTACATACAGAGAGAGGATGG + Intronic
905590281 1:39157332-39157354 TTGTAAAAACAGAGAGAAAAGGG - Intronic
906172382 1:43738102-43738124 TGGTAAAAAGAGAGAGAGAAAGG + Intronic
906684874 1:47756783-47756805 GGGTGGAAACAGAGAGAGGCAGG - Intergenic
908147214 1:61259358-61259380 ATGGAAGAACAGAGAGGGGAAGG - Intronic
908609919 1:65846238-65846260 GAGAAAGCACAGAGAGAGGAGGG + Intronic
908927645 1:69275474-69275496 GAGTAGAGACAGAGAGGGGAGGG + Intergenic
909626362 1:77720210-77720232 GTGGAAAAAAAGATAAAGGATGG + Intronic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912303103 1:108536805-108536827 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
912628598 1:111227361-111227383 GTGTGAACACAGAGAGAGGTGGG + Intronic
912839908 1:113030242-113030264 AAGTAAAAACAAAGAGAAGAAGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913257599 1:116967992-116968014 GAGTATAAAGAAAGAGAGGAGGG + Intronic
914238325 1:145832721-145832743 GAGTTAAAATAGAGAGAGAAAGG + Intronic
914829830 1:151162874-151162896 GAGTAGAAATAGAGCGAGGAAGG - Intronic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915396011 1:155584741-155584763 GTCTAAAAAAAGAGAGAGAGAGG - Intergenic
916386405 1:164276610-164276632 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
916932454 1:169592885-169592907 GTGTAAAATCAATGAGAAGATGG - Intronic
917116286 1:171607135-171607157 GTGGAAAAACAGACATATGAAGG - Intergenic
917159301 1:172039774-172039796 GAGGAAGAACAGAGAAAGGAAGG - Intronic
917770155 1:178268624-178268646 GAAAAAAAAGAGAGAGAGGAGGG + Intronic
919166071 1:193894984-193895006 ATGCAAAAACAGAGAGGAGAAGG - Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919414105 1:197285299-197285321 GAGTGAAAATAGAGAGATGATGG + Intronic
919846094 1:201643143-201643165 GGGAAGAAAGAGAGAGAGGAAGG - Intronic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921421705 1:214956310-214956332 GTGTAAAAACAGTGTTATGAAGG + Intergenic
921734535 1:218612162-218612184 GGGGAAAGAGAGAGAGAGGAAGG - Intergenic
921940148 1:220830702-220830724 GTGTAAAATGAGAGATTGGATGG + Intergenic
922177698 1:223209451-223209473 GGGTAAAAAGAAAAAGAGGAGGG + Intergenic
922580672 1:226695600-226695622 GTGTGAGAAGAGAGAGAGGATGG - Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922996135 1:229963092-229963114 GTGTAAACAAGGAGAGAGGTGGG + Intergenic
923024560 1:230194494-230194516 GTGTACAGTCAGAGAGGGGATGG - Intronic
923058621 1:230449259-230449281 GTGTCCAAACAGAGTGAAGAGGG - Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063350474 10:5349553-5349575 GTGTTCTAACAGAGAGAGTAAGG - Intergenic
1063745485 10:8875082-8875104 GTGAAAAAACTGGGAGAGGGAGG + Intergenic
1063890678 10:10625143-10625165 GTGTAAAAACATAGGGAAGGTGG + Intergenic
1063897914 10:10701664-10701686 GTGCAAAGACAGAGAAAGGATGG + Intergenic
1063959401 10:11294457-11294479 GTGTAAGAAGAAAAAGAGGACGG - Intronic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1064891085 10:20174594-20174616 GTGGAAAAAAAGACACAGGAAGG + Intronic
1065598557 10:27344630-27344652 GTGTCTAAACATAGACAGGAGGG + Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065754833 10:28921812-28921834 TTGGAAAAAAAGGGAGAGGAGGG + Intergenic
1065772071 10:29086987-29087009 GTGAACACACAGAGAGAAGAAGG - Intergenic
1065792167 10:29270626-29270648 GTTTAGACAGAGAGAGAGGACGG + Intergenic
1065918479 10:30371165-30371187 GTATAAAAACAGCAAGAGGCTGG + Intronic
1065941175 10:30565192-30565214 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1066596188 10:37052567-37052589 GAGAAAAAACAGAGGGAGAAAGG + Intergenic
1067054063 10:43041098-43041120 GGGAGAAGACAGAGAGAGGAGGG + Intergenic
1067535406 10:47106062-47106084 GTGAAAAAAGAGAGAGAAGGGGG - Intergenic
1067711501 10:48654837-48654859 GAGAAAGAAAAGAGAGAGGAAGG - Intronic
1067714234 10:48674223-48674245 TTGAAAAAAGAGAGAGAGGCTGG - Intergenic
1069350713 10:67523543-67523565 GTGCAAAAAAAGAGAGATAAAGG + Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069929134 10:71870432-71870454 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070694037 10:78548614-78548636 GAAAAAAAAGAGAGAGAGGAAGG + Intergenic
1070933326 10:80275762-80275784 GTGTAGAAACACAGAGTAGAAGG - Intronic
1071089382 10:81901043-81901065 GTGGAAAAGGAGAGAGAGTAGGG - Intronic
1071204230 10:83255080-83255102 GTCTCAAAACAAAGAGAGGAAGG - Intergenic
1072404097 10:95133432-95133454 GCATACAAAGAGAGAGAGGATGG + Intergenic
1072830322 10:98650666-98650688 GTGTAAAAACACAGTGACCAAGG + Intronic
1073047682 10:100650427-100650449 GGGTAAAGACAGAGAGGAGAAGG + Intergenic
1073580356 10:104660039-104660061 GTGAGAAAAAAGAGAAAGGAAGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073871209 10:107866493-107866515 CTATAAAAACAGAGATAGGGAGG - Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075280478 10:121134284-121134306 GTGGACAGAGAGAGAGAGGAAGG - Intergenic
1075902287 10:126052645-126052667 GGATAAAAACAAAGAGAGGAAGG + Intronic
1076054963 10:127364859-127364881 ATGGAAAAAAAGAGAGAGAACGG - Intronic
1076309249 10:129492393-129492415 GCGGAAAGACAGAGAGAGAAGGG - Intronic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1077548965 11:3191173-3191195 GTGAAAAGATAGAGAGAGGGCGG + Intergenic
1077975443 11:7243500-7243522 GTGTACACAGAAAGAGAGGAAGG - Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1078388216 11:10911839-10911861 GTGTAAAGACAGAAACAGAAAGG + Intergenic
1079189346 11:18264950-18264972 GAGGAAAGAAAGAGAGAGGAAGG + Intergenic
1079214721 11:18498353-18498375 GTGTCAAAAAAGAGAGATGTAGG + Intronic
1079515774 11:21266587-21266609 GTAGAAAAAGAGAGAGAGAAGGG - Intronic
1081027567 11:38034926-38034948 GAGTGAAAACAGAGACAGAAAGG + Intergenic
1081355268 11:42105044-42105066 GTGAAAAAACAGGGAAAAGATGG + Intergenic
1081577409 11:44327753-44327775 GTAGAAAAAAAGAGATAGGAAGG + Intergenic
1081577479 11:44328254-44328276 GTGTAGAAAAAAAGACAGGAGGG - Intergenic
1082008439 11:47434333-47434355 TTGTAAGAACACAGAGAGAAGGG + Intergenic
1083549034 11:63572020-63572042 GAAGAAAGACAGAGAGAGGAAGG + Intergenic
1084122731 11:67078603-67078625 GTCTAGACACAGGGAGAGGATGG + Intergenic
1084508833 11:69589089-69589111 GTGTACAAGCATAGATAGGAAGG + Intergenic
1086245888 11:84752428-84752450 GTGTAAGAAGAGAGAGTAGAAGG + Intronic
1086362530 11:86073701-86073723 GTGTAAACACAGAAAGGTGAGGG - Intergenic
1086649994 11:89276812-89276834 GTGTAAACACACAGAGAACAGGG + Intronic
1086931670 11:92700258-92700280 GTGTAAAGGCAGAGTGGGGATGG + Intronic
1087047243 11:93852219-93852241 GTTTAAAAAAAAAGATAGGAAGG + Intergenic
1087549873 11:99635666-99635688 GTGTGAAAACAAAGAGGAGAGGG + Intronic
1087599708 11:100297798-100297820 GGCTAAAAACAGTGGGAGGAAGG + Intronic
1087973200 11:104511655-104511677 AGATAAAAACAGAGAAAGGAGGG + Intergenic
1088048872 11:105486281-105486303 TTGTAAATAGTGAGAGAGGATGG + Intergenic
1089229402 11:116958580-116958602 GTATAACAACAGACAGAGGATGG + Intronic
1089342968 11:117772123-117772145 GGGTGTCAACAGAGAGAGGAGGG + Intronic
1089760346 11:120718255-120718277 GGGTAAAGACGGGGAGAGGAGGG - Intronic
1089905920 11:122038336-122038358 GAGGCAAAAGAGAGAGAGGAAGG + Intergenic
1090684209 11:129097715-129097737 GAATAAAAAAAGAGAGAGAAGGG + Intronic
1090785632 11:130044868-130044890 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
1091063451 11:132486692-132486714 GTGTAAAAAAAGAGAAAAAAAGG - Intronic
1091099527 11:132858012-132858034 ATGTGAACACAGAGAGAGGGAGG + Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091859262 12:3764830-3764852 GGATAAAAGCAGGGAGAGGAAGG - Intergenic
1091904633 12:4174560-4174582 AGGAAAAAACAGAGAGGGGAGGG - Intergenic
1092028773 12:5265900-5265922 GTCTAAAAATAAAGAGAGGGAGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1093145991 12:15567499-15567521 GGGAAAAGAGAGAGAGAGGAAGG - Intronic
1093216060 12:16362294-16362316 GAATAAAAGCAAAGAGAGGATGG - Intronic
1093823265 12:23648600-23648622 GTGTGAACACAGAGAGAAGGTGG + Intronic
1093993364 12:25614884-25614906 GTGTGAAAACAGGGAGAAGATGG - Intronic
1095854538 12:46845440-46845462 GGGGAAAAAGAGAGTGAGGAGGG + Intergenic
1096596489 12:52699156-52699178 GAGTAAAAATAGAGAGTGGCAGG - Intronic
1096648525 12:53050646-53050668 GTGGAAAAAGAGAGAGGAGAGGG + Intronic
1096860418 12:54523262-54523284 GTGGAAGGAAAGAGAGAGGAAGG + Intronic
1097349311 12:58530655-58530677 GTGTAAAAAAAGAAAGTGAAGGG + Intergenic
1097397844 12:59097731-59097753 GGGAAAAAGAAGAGAGAGGAGGG + Intergenic
1097832310 12:64238641-64238663 GTGGAAAAAGAGAGAGAGATAGG - Intergenic
1097909718 12:64957034-64957056 GTGTAAAAACAAAGACTTGAAGG + Intergenic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098507251 12:71267496-71267518 GTTTAAAGAGAGAAAGAGGAGGG - Intronic
1098689315 12:73466641-73466663 GGGAAAACACAGAGAGAAGATGG + Intergenic
1098800153 12:74946527-74946549 GGGTAAAAACAGAGAAAGACTGG + Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098862526 12:75725892-75725914 GTGTAAAAAGAAACAGAGCAAGG + Intergenic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099348928 12:81540038-81540060 GTGGAAAAACAGAGAGAGAGAGG + Intronic
1099387135 12:82028280-82028302 GGGCAAAGAGAGAGAGAGGAAGG - Intergenic
1100633275 12:96409260-96409282 GGTTAAAAACAGAAAGAGAATGG + Intergenic
1100641486 12:96485721-96485743 CTCAAAAAAAAGAGAGAGGAGGG - Intergenic
1100841266 12:98614095-98614117 GTGTAAAAACAGATATACGACGG - Intronic
1100908235 12:99326497-99326519 ATTCAAAAACAGAGAGAAGAAGG - Intronic
1101193627 12:102360555-102360577 GTGTTAGAACAGAGAAAGGAAGG - Intergenic
1101506155 12:105348462-105348484 TTTCAAAAACAGAGAAAGGAGGG - Intronic
1101547549 12:105730670-105730692 GAGTCAAATCTGAGAGAGGAAGG - Intergenic
1101626317 12:106445754-106445776 CTGTAAAAATACAGAGAGGGAGG + Intronic
1102231630 12:111266526-111266548 GTGTAAAAACAGAGGCACGGTGG + Intronic
1103147590 12:118609072-118609094 GAGGAAAAAAAAAGAGAGGAAGG + Intergenic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1103769199 12:123307353-123307375 GGGAAAAAAAAGAGAAAGGAAGG + Intronic
1104300556 12:127560907-127560929 GTGTAAACACAGGGAGAGGCAGG + Intergenic
1104833973 12:131775096-131775118 GTGTTAAAACAGAGGGGAGATGG - Intronic
1105296215 13:19089828-19089850 GTGGGAAATGAGAGAGAGGAGGG + Intergenic
1105686550 13:22788835-22788857 GAGTAACAAGTGAGAGAGGATGG - Intergenic
1105738375 13:23295949-23295971 GTGCAAAAGCACAGAGGGGATGG - Intronic
1106082367 13:26511055-26511077 GTGAAAACACAGGGAGAGGCTGG + Intergenic
1106227387 13:27795329-27795351 GCCTTAAAACAAAGAGAGGAGGG - Intergenic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107592961 13:41927674-41927696 GGGTAACAACAGAGAAAGAAAGG + Intronic
1107918855 13:45182515-45182537 GTATAAACATAGAGAGAGAAAGG - Intronic
1108129101 13:47277679-47277701 GAGTAAAAATTGATAGAGGAGGG + Intergenic
1108139508 13:47404884-47404906 GTGTAAACACAGAGAGGAAATGG - Intergenic
1108259125 13:48639448-48639470 GTATAAAAACAGAAAAAGGCCGG + Intergenic
1108602907 13:52010212-52010234 GTGGACAGACAGAGAGAGGCTGG - Intronic
1108759390 13:53544786-53544808 GTGAAAAAATAGAGAGACAAAGG - Intergenic
1108770782 13:53698378-53698400 GTGTAAAAATATATAGAAGAAGG + Intergenic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1111390601 13:87589926-87589948 TTGTAAATATATAGAGAGGAAGG + Intergenic
1112521219 13:100097095-100097117 ATGTACAAACAGGGAAAGGAAGG + Intronic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1114061693 14:19023931-19023953 GTGTAATAACAGTGACAGAATGG + Intergenic
1114100568 14:19376075-19376097 GTGTAATAACAGTGACAGAATGG - Intergenic
1114428616 14:22641304-22641326 GAGGAAAGAGAGAGAGAGGAAGG + Intergenic
1114719772 14:24868792-24868814 TAGTAAAAACAGAGAGAAAAGGG + Intronic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115197468 14:30816867-30816889 GTGAAGAAAGAGAGAGAGGTAGG - Intergenic
1115616476 14:35100032-35100054 GTGTAAAAAGAGGGAAAGGCTGG - Intronic
1115808164 14:37075783-37075805 ATGTAATAACAGACAGATGATGG + Intronic
1116551993 14:46252224-46252246 ATTTAAAAACAGAAAGAGAATGG - Intergenic
1116953326 14:50898481-50898503 GTGTTACAGAAGAGAGAGGAAGG + Intronic
1117532638 14:56674421-56674443 GTGTAAGAACAGAGATGCGAGGG + Intronic
1117958141 14:61138239-61138261 GGGTAGAGACACAGAGAGGAGGG + Intergenic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1118347990 14:64953666-64953688 GAGTGACAACAGAGAGATGAGGG + Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1118626704 14:67665854-67665876 GTTTAAAAAAAGGTAGAGGAAGG + Intronic
1119620736 14:76130230-76130252 GTAGAAAAACAGAGAAGGGAGGG - Intergenic
1119937700 14:78608013-78608035 GTTTAAAAATGGAGACAGGAGGG + Intronic
1120657200 14:87205967-87205989 GTATAAAGACAGAGACAAGAGGG - Intergenic
1120873756 14:89360413-89360435 AGGTAAAAAGAGAGGGAGGAAGG + Intronic
1121184693 14:91956415-91956437 GTGTAAAGAAATAGAAAGGAGGG + Intergenic
1121471406 14:94157207-94157229 GTGAAAGAACAGAGAGGGCAAGG - Intronic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122527301 14:102396512-102396534 GATTAAAAACCTAGAGAGGAAGG + Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1124795690 15:32775900-32775922 TTGAAAAATCCGAGAGAGGAGGG + Intronic
1124969430 15:34471339-34471361 GTGTAAGAAAATAGAGATGAGGG + Intergenic
1125025204 15:35022742-35022764 GGGAAAAGAGAGAGAGAGGAAGG - Intergenic
1125072443 15:35571941-35571963 GAGCAAAGACAGAGTGAGGAAGG - Intergenic
1125552709 15:40559087-40559109 GTTGAGAAAGAGAGAGAGGAAGG - Intronic
1125615778 15:41011140-41011162 ATGTAAAAAGAGAGATAGAAAGG - Intronic
1126138559 15:45416750-45416772 GTCTAAAAGCAGACAGAGAAAGG - Intronic
1126316846 15:47378993-47379015 GTTTTAAAACAGAGACAGAAAGG + Intronic
1126799281 15:52285492-52285514 GTGGAAAGAGAGGGAGAGGACGG - Intronic
1127160519 15:56179743-56179765 GTGTTGAGACAGAGAGAGGAGGG - Intronic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128436275 15:67652439-67652461 GTGGAGCAAGAGAGAGAGGAGGG + Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129459995 15:75695768-75695790 GTGTACAGACACAGAGAGGGAGG + Intronic
1129520391 15:76182338-76182360 GTTAAAAAAAAGAGAGAGGTCGG + Intronic
1129663437 15:77566136-77566158 GTGTAGAAAGAGAAAGAGAAAGG + Intergenic
1130696187 15:86134112-86134134 GTGTGAAGACAGAGAGCGGCTGG + Intergenic
1130765183 15:86862962-86862984 GGGCAAAAACTGTGAGAGGATGG + Intronic
1131304507 15:91229926-91229948 TTTTTAAAACAGAGAGAGGATGG - Intronic
1131827127 15:96330975-96330997 ATGATAAAAGAGAGAGAGGAGGG - Exonic
1131935118 15:97495459-97495481 GTGTAAAATCAGGGAGAGGAAGG - Intergenic
1132102926 15:99039665-99039687 GCATAAAAAGAGAGAGAGAATGG + Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132300934 15:100774983-100775005 GTGGAAAGAGAGGGAGAGGAGGG + Intergenic
1133510636 16:6454022-6454044 GTGAAAACCCAGAGAGAAGACGG - Intronic
1133698284 16:8285873-8285895 AGGTAAAAAGAGAGGGAGGATGG - Intergenic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1133966804 16:10537603-10537625 GTGTCTCAATAGAGAGAGGAGGG - Intronic
1134351767 16:13444366-13444388 GTGAAAAGAAAGAGAGAAGAAGG + Intergenic
1134619155 16:15674543-15674565 GTTTAAAAACAAAGACAGGCCGG - Intronic
1135137339 16:19894953-19894975 ATGTGAAAACAGAGAGAGAGAGG - Intergenic
1135165939 16:20139200-20139222 GTGAAAAAACAGAGTGTAGAGGG - Intergenic
1135618128 16:23929600-23929622 CTGTAACAACACAGAGACGATGG + Intronic
1135817755 16:25651355-25651377 ATGTAAAATCAATGAGAGGAGGG + Intergenic
1135879280 16:26238424-26238446 GGGCAAGAAGAGAGAGAGGAGGG + Intergenic
1137238720 16:46636793-46636815 GTGAAAGAACAGAGACATGAAGG - Intergenic
1137534252 16:49305705-49305727 GGGGAGAAACAGGGAGAGGAAGG - Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1138599824 16:58047723-58047745 GTTTCAACACAAAGAGAGGAAGG - Intergenic
1138626511 16:58256206-58256228 GTTTAGAAAGAGAGAGAGGAGGG - Intronic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139047730 16:63083338-63083360 GTGTAAGAAAAGAGAGAGAGAGG - Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1140206349 16:72936879-72936901 GTTGAAATACAGAGAGACGATGG + Intronic
1140588159 16:76319382-76319404 GTCTCAAAAGAGAGAGAGGGAGG + Intronic
1143655453 17:8291103-8291125 GTGCAAAAACAGTGAGAAGGAGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144409311 17:14985082-14985104 GTTTGAAATCAGAGAAAGGAAGG + Intergenic
1145985710 17:29044830-29044852 GTGGAAAACAAGAGAGATGATGG - Intronic
1146266725 17:31457840-31457862 GGGGAAAAGGAGAGAGAGGAAGG - Intronic
1146469764 17:33114859-33114881 GTGGAAAAACTGAGAGAGGCTGG - Intronic
1147632480 17:41941010-41941032 TGGCAAAAACAGAGAGGGGAAGG - Intronic
1147873485 17:43604219-43604241 GAGTATATACAGAGAAAGGATGG + Intergenic
1148025506 17:44584843-44584865 GGGAAAAGAGAGAGAGAGGAGGG - Intergenic
1148715345 17:49711702-49711724 TTTTAAAAATAGAGAGATGAGGG - Intronic
1148760135 17:49995390-49995412 GGGAAAAAGAAGAGAGAGGAGGG - Intergenic
1149525449 17:57351985-57352007 GTGAAGAAACACTGAGAGGAAGG + Intronic
1149620469 17:58041073-58041095 GTTTAAAAGAAGAGAGAGGGGGG - Intergenic
1149946631 17:60934860-60934882 ATGTAAAAACAGTAAGAGGCTGG + Intronic
1150122844 17:62617986-62618008 ATGTAAAATCAGAGAGTGGCTGG - Intergenic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151140831 17:71990733-71990755 TTCTAAAAAAAGAGAGAAGAAGG - Intergenic
1151162653 17:72178501-72178523 GGGCAAAATCAGAGAGAGAAAGG - Intergenic
1152042005 17:77909673-77909695 GTGTAAAATTAGAGACTGGATGG - Intergenic
1152728049 17:81957317-81957339 GTAAAGAGACAGAGAGAGGAAGG - Intronic
1152818492 17:82423516-82423538 GTTAAAAAAAAGAGAGAGGCCGG + Intronic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153890373 18:9508650-9508672 GTTTATAAACAGAGAAAGTAAGG - Intronic
1155645389 18:28071229-28071251 GGGGAAAAAGAGAGAGAGAAAGG - Intronic
1155730618 18:29153229-29153251 GTGTATACACAGAGAAAGAAGGG + Intergenic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1157340534 18:46773892-46773914 GTGTAGACAGAGAGAGAGGGAGG - Intergenic
1158531177 18:58263094-58263116 GAGTCAAATCAGAGATAGGAGGG - Intronic
1158762984 18:60412308-60412330 GTGCAAAGACAGAGAGAAGGTGG + Intergenic
1158798591 18:60878565-60878587 GTGTATATACATAGAGAAGATGG + Intergenic
1160318597 18:77869678-77869700 GTAGAAAAACACAGAGAGCAAGG + Intergenic
1160411055 18:78675679-78675701 GTGTAGAAACAAACAGAGGAAGG - Intergenic
1161096428 19:2394528-2394550 GAGTAGAAACAGAGTGAGGTTGG + Intronic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1161899346 19:7106454-7106476 AGATAAATACAGAGAGAGGAAGG + Intergenic
1161926383 19:7303443-7303465 GTCTCAAAAAAGAGAGAGAAAGG + Intergenic
1163276398 19:16287147-16287169 GGGTAGAGACAGAGAGACGAGGG - Intergenic
1163973366 19:20822243-20822265 ATGCAAAAACAGAGAAATGAAGG - Intronic
1164482416 19:28622701-28622723 GAGCAAAAACAGAAAGAGAAGGG + Intergenic
1164820435 19:31246591-31246613 GTTTAAAAAGGGACAGAGGAAGG + Intergenic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1165639585 19:37372767-37372789 TTGTAAAAATAGAGACAGGCTGG - Intronic
1166528998 19:43531286-43531308 GTGCAAAAAAAGAAAGAGGTGGG + Intronic
1166832578 19:45647561-45647583 GTGGAAAGAGAGGGAGAGGAGGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167701169 19:51046949-51046971 GGGCAAAAACAGGAAGAGGAGGG + Intergenic
1167798391 19:51725403-51725425 AGGTAAAAGCAGAGAGAGAATGG - Intergenic
1167824695 19:51961522-51961544 GTGTCAGAACAGGGAGAGCAAGG + Intergenic
1168149554 19:54437688-54437710 GACAAAAAACAGAGAGAGGCTGG + Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925729707 2:6910382-6910404 GTGTAGAAAGAGAGAGAGAGAGG + Intergenic
926135038 2:10330571-10330593 GTGTGAGAACAGAGGGAGAAAGG - Intronic
926390884 2:12391427-12391449 CTATAAAAAGAGAGTGAGGAGGG - Intergenic
926531610 2:14054009-14054031 GTGTAAATGCAGAGAAAAGAAGG - Intergenic
926809372 2:16742677-16742699 GAGAAAGAACATAGAGAGGAGGG + Intergenic
926935406 2:18082806-18082828 GAGTAAAAAGAAAAAGAGGAGGG - Intronic
926986128 2:18626070-18626092 TTCTAAAAAGAGAGAAAGGAAGG + Intergenic
927368466 2:22326899-22326921 GTGCACACACAGAGAGAAGAAGG + Intergenic
927372161 2:22368803-22368825 ATGTAAACAAAGAGAGAGAATGG + Intergenic
928180894 2:29067533-29067555 ATGTAAAAAAAGAGAGAGAGGGG - Intronic
928182935 2:29082519-29082541 GGGTAAAAAGAGAGAAAGGGGGG + Intergenic
928235503 2:29535974-29535996 GTGTAAATCGGGAGAGAGGAAGG - Intronic
930036821 2:47091089-47091111 AAGAAAGAACAGAGAGAGGAAGG + Intronic
930542453 2:52723905-52723927 GTGTCAAAACAGAGAGAAGGAGG + Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931626929 2:64264842-64264864 GTGTTCAAACAAACAGAGGAAGG - Intergenic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932672018 2:73746102-73746124 ATGTAAGAACAGAGAGGTGAGGG + Intergenic
933132662 2:78691833-78691855 GTGTGAAGACAGAGAGAGAGAGG - Intergenic
933300572 2:80536288-80536310 ATATAAAACCACAGAGAGGATGG - Intronic
933949191 2:87313793-87313815 GTGTGGAAACAGAGAGAAGGCGG - Intergenic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935468204 2:103425038-103425060 GTGAAGAAACACAGAGAAGATGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935697814 2:105785323-105785345 GTGTAAAAAGAACCAGAGGACGG + Intronic
935847888 2:107187041-107187063 GGGAAAGAACTGAGAGAGGATGG + Intergenic
936339187 2:111616476-111616498 GTGAAAAGACAGCGAGAGGGCGG - Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937715979 2:125033092-125033114 ATGTAAAAACAAAGTGAGGAAGG - Intergenic
937727163 2:125180878-125180900 ATGCACACACAGAGAGAGGAAGG - Intergenic
938389035 2:130890242-130890264 GTGTAAGAGAAGAGACAGGAAGG - Intronic
939011290 2:136848873-136848895 GTCTAAAAACTGAGAGAGAAGGG - Intronic
939026930 2:137025168-137025190 GTGAGAAAAAAGAGAGAGGCAGG - Intronic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
939783351 2:146476960-146476982 GTGTAAAAGCAGCCAGAGGAAGG + Intergenic
939818618 2:146927848-146927870 ATTTGAAAAGAGAGAGAGGAAGG + Intergenic
939972951 2:148682671-148682693 ATGAAAATACAGTGAGAGGAGGG - Intronic
940179949 2:150920929-150920951 GTTCATAAACAGAGAGATGATGG - Intergenic
941451600 2:165666649-165666671 GAGGAAGAAAAGAGAGAGGAAGG + Intronic
941463720 2:165800768-165800790 ATATAAAAACGGAGTGAGGATGG + Intergenic
941629264 2:167866032-167866054 GCATAAAATGAGAGAGAGGATGG - Intergenic
941688141 2:168468779-168468801 GAGGAAAAAAAGAGAGAGAAGGG - Intronic
942007628 2:171721336-171721358 GTGTAAAAAAAGAAAGGGAATGG + Intronic
942132219 2:172891712-172891734 GTGTAAAAACAGTGACAGAATGG + Intronic
942336793 2:174896987-174897009 GTGAAAGAGCACAGAGAGGAGGG + Intronic
943061420 2:183045074-183045096 GGGTAAAGACACAGAGAGAAGGG - Intergenic
943065838 2:183085218-183085240 GTGTAAAGTAAGAGAGAAGAGGG + Intronic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
943393306 2:187298612-187298634 ATATAAAAACAGACAAAGGAGGG - Intergenic
943585556 2:189735157-189735179 GTGTAACAAAAGGGAGAAGAAGG - Intronic
943760417 2:191601885-191601907 GTATATAAACAGGGAGAGGAGGG - Intergenic
944078353 2:195757621-195757643 GTGTAGAAACAAAGAGGGGAAGG + Intronic
944287683 2:197970243-197970265 GTGTGTAAAAAGAGAGAGCATGG + Intronic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945232329 2:207605632-207605654 GTGTAAAAAAAGGGAGAGGGAGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
946458191 2:219846578-219846600 GTGAAAACACAGGGAGATGATGG + Intergenic
947082563 2:226415008-226415030 AGGTAAAGAGAGAGAGAGGAAGG + Intergenic
947801500 2:232931093-232931115 ATAGAAAAAGAGAGAGAGGAAGG + Intronic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
948659098 2:239496039-239496061 GCTTAACAACAGAGAGAGGGAGG + Intergenic
948880029 2:240851937-240851959 GTGGAAACACAGGGAGAAGACGG - Intergenic
1170101498 20:12705408-12705430 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1170609816 20:17903344-17903366 TTTTAAAAAAAGAGAGAGGGCGG - Intergenic
1170833153 20:19860723-19860745 GTGCTAAAACAGAGAGAGAGGGG - Intergenic
1173033271 20:39381931-39381953 TTGTACAAACAGAGTAAGGATGG + Intergenic
1173343624 20:42177869-42177891 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1173558839 20:43987532-43987554 GTGTAAAAAAAGAAAGATCAAGG + Intronic
1173617821 20:44414342-44414364 GGGTAAAAACGGAGGGAGGGAGG - Intronic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1176519907 21:7816505-7816527 GTGTCAGAACAGAGAGATGTGGG - Intergenic
1177963259 21:27695405-27695427 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1178160272 21:29904409-29904431 GTGTAAAATCAGCAAGAGCAGGG + Intronic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178653935 21:34446518-34446540 GTGTCAGAACAGAGAGATGTGGG - Intergenic
1178792334 21:35712022-35712044 GTGAAAACACAGGGAGAGGATGG - Intronic
1178803364 21:35817737-35817759 GTGAAATCACAAAGAGAGGATGG + Intronic
1179560268 21:42211461-42211483 AGGTAGAGACAGAGAGAGGAAGG - Intronic
1180739846 22:18045443-18045465 AAGTAAAGAAAGAGAGAGGAAGG - Intergenic
1182819349 22:33201677-33201699 GAGTAAAGAAAGAGAGTGGAGGG + Intronic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
1184583847 22:45434589-45434611 ATGTAAAGCCAGAGAGGGGAGGG + Intergenic
1184928421 22:47660891-47660913 GTGTATTGCCAGAGAGAGGAGGG - Intergenic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
949111969 3:271742-271764 GAGAAACCACAGAGAGAGGAAGG + Intronic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949295327 3:2514937-2514959 GGGTAGAAAGAGAGAGAGGGAGG - Intronic
949329420 3:2905404-2905426 GTGCAAACACAGTGAGAGGTTGG - Intronic
949786499 3:7747254-7747276 GTATAATAACAGACAGTGGAAGG + Intergenic
949986477 3:9545199-9545221 GTACTAAAAAAGAGAGAGGAAGG + Intronic
949995787 3:9615674-9615696 CTCTAAAAAAAGAGAAAGGAAGG + Intergenic
950271409 3:11618896-11618918 ATGTAAAAAGAGAGAGAGGTGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951277229 3:20703082-20703104 GTGTAAAATAATATAGAGGAAGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
952287101 3:31980296-31980318 GTTTAAAAACAGAAAGAGGCCGG - Intronic
952801388 3:37295670-37295692 TATTTAAAACAGAGAGAGGACGG - Intronic
952822908 3:37500221-37500243 GTGTAAAAAGAATGAGTGGATGG + Intronic
953037623 3:39227073-39227095 GTGGAAAGAGAGGGAGAGGAGGG - Intergenic
954122056 3:48505140-48505162 GTGTTAGAACAGGGAGAGGAAGG + Intergenic
954514403 3:51159535-51159557 GTCTAAAAACAGGGAGCAGAAGG - Intronic
954767777 3:52935848-52935870 GAGTAAAAAAAGAGAGAGTAGGG - Intronic
954907672 3:54076708-54076730 AAAAAAAAACAGAGAGAGGAAGG - Intergenic
956457129 3:69433413-69433435 GTGTAAAAACAGGACAAGGAGGG + Intronic
956777126 3:72574666-72574688 ATCTATAAACAGAGAGAAGAGGG + Intergenic
957191143 3:77011194-77011216 GTATATAAACAGGGAAAGGAAGG - Intronic
957387525 3:79516545-79516567 GTGTATAAACAAAGAGACTATGG - Intronic
957737892 3:84225906-84225928 AGGTAAAAACAGTGAGAGGCAGG - Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
959364634 3:105441670-105441692 GTGGAAAAACAGACATTGGAAGG - Intronic
959416032 3:106076755-106076777 GTTGAAAAAGAGAGAGAGAAAGG + Intergenic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961514554 3:127424603-127424625 GTGTGTGAACAGAGAGAGGGAGG - Intergenic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962327933 3:134451237-134451259 GTGTAAAAAGTGACAGAGGACGG - Intergenic
964375998 3:156049792-156049814 GTGATAGAACAGAGAGGGGAAGG - Intronic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
964984270 3:162719704-162719726 GTGAAAATACAGCTAGAGGATGG + Intergenic
965553478 3:169995544-169995566 ATGTAAAACCAGAAAGAGGGGGG - Exonic
965664503 3:171078562-171078584 ATGTAAAAAGAAAGAAAGGAAGG - Intronic
965876801 3:173333446-173333468 GGGTATAAACAGAGATAGGAAGG - Intergenic
965898449 3:173608734-173608756 AGGAAAAAAGAGAGAGAGGAAGG - Intronic
966331378 3:178818606-178818628 GTTTAAAAAAAGAGAAATGATGG - Intronic
966602715 3:181791041-181791063 GTGGGAGAAGAGAGAGAGGAAGG + Intergenic
967108988 3:186276564-186276586 GTGAAAAGACAGACAGAGAAAGG + Intronic
967232695 3:187355285-187355307 TTGTAGAAACAAAGAAAGGAAGG - Intergenic
967521430 3:190437154-190437176 GTGAAAGAATAGAGTGAGGATGG + Intronic
967581646 3:191164174-191164196 GAATAAGAAAAGAGAGAGGATGG + Intergenic
968146299 3:196301750-196301772 ATGTAAAAATAGAGTGGGGAGGG + Intronic
969166471 4:5320143-5320165 GTGTAGAAACACATAGGGGAGGG - Intronic
970254417 4:14152845-14152867 GTGTGAAATCAGAGTGAGGTGGG - Intergenic
970408015 4:15782068-15782090 GTGTGGCAACACAGAGAGGAAGG - Intronic
971163633 4:24159711-24159733 ATGTAAACTCACAGAGAGGAAGG - Intergenic
971688771 4:29805312-29805334 GTGTAAGATAAGAAAGAGGAAGG - Intergenic
971884901 4:32432076-32432098 GGGTGGAAAGAGAGAGAGGAGGG - Intergenic
972623163 4:40768911-40768933 GTGAAAAAGTAGAGAAAGGAGGG + Intronic
972985724 4:44762201-44762223 GTTTAATAGCAGAGAGAAGATGG + Intergenic
973575878 4:52288794-52288816 GTTTAAAACCAGGGAAAGGAGGG + Intergenic
974088863 4:57289642-57289664 GTGGAAACGCAGAGAGAAGATGG + Intergenic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974587279 4:63895994-63896016 CTGTGAAAACAGTGAGAGGGTGG - Intergenic
975293150 4:72700864-72700886 ATGAAATAACAGAGAGTGGATGG - Intergenic
975651271 4:76596058-76596080 GTATATAGACAGAGAGAGCAAGG - Intronic
975818718 4:78247522-78247544 GTGAAGAAAGAAAGAGAGGAAGG - Intronic
976299190 4:83501954-83501976 GTCAAAAAAAAGAGAGAGAAAGG - Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976853413 4:89575710-89575732 GTGTGAACAAAGAGATAGGATGG + Intergenic
976874435 4:89836779-89836801 TTTTAAAAAAAGAGAGAGGCGGG - Intronic
977102536 4:92835249-92835271 GTGTCAAAACAAAGGTAGGAAGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977400638 4:96527115-96527137 ATTTAAGAACAGAGAGAAGAAGG + Intergenic
977429346 4:96911892-96911914 GTGTAAGAAAAGAGAGAGAGAGG + Intergenic
978084957 4:104640069-104640091 GGGGAAAAATAGAGAGAGAAGGG + Intergenic
978086384 4:104660694-104660716 GTTTACAGACAGAGAAAGGAAGG + Intergenic
978286692 4:107086321-107086343 ATGGAAAGAGAGAGAGAGGAAGG + Intronic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
979838192 4:125401015-125401037 GTGTAGAAAGGCAGAGAGGATGG + Intronic
980002263 4:127503708-127503730 GTGTTAAAACAGATAAAAGAAGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980706474 4:136503063-136503085 GAGTAAACACAGTAAGAGGAGGG + Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
982318986 4:154059560-154059582 AGGTAAAAGCAAAGAGAGGATGG - Intergenic
982736642 4:159013550-159013572 AGGTGAAGACAGAGAGAGGAAGG + Intronic
983492924 4:168410641-168410663 ATTTAATAACAGAGATAGGATGG + Intronic
983699182 4:170570264-170570286 GGCTAAAAATAGAAAGAGGACGG - Intergenic
983798866 4:171902259-171902281 TTGTAAAAAAAGAGAGAGGTGGG + Intronic
983854100 4:172620187-172620209 GTTTAAAGAAAGGGAGAGGAAGG + Intronic
983889147 4:173013105-173013127 TTATAGAAACAGACAGAGGAAGG - Intronic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984568960 4:181366713-181366735 GATAAAAAACAGAGTGAGGAAGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
985040043 4:185880986-185881008 GTGAAGAAAAAGAGAAAGGAAGG + Intronic
985375231 4:189329489-189329511 GTCTTAAATCTGAGAGAGGAAGG - Intergenic
985816087 5:2129248-2129270 GTTTAATAAAAGAGAGGGGAAGG + Intergenic
985945559 5:3179614-3179636 GTTTCAAAACAGAGAAGGGATGG + Intergenic
986641232 5:9873977-9873999 GAAGAAAAAGAGAGAGAGGAAGG + Intergenic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
987683896 5:21171798-21171820 GTCAAAAAACAGGGAGAGGAGGG + Intergenic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
987729415 5:21749213-21749235 GTGAACACACAGAGAGAAGACGG + Intergenic
987779370 5:22413903-22413925 ATGTATAAAGAGAGAGAGAAAGG - Intronic
987826763 5:23040197-23040219 GTGAAAAGACAGGGAGAAGATGG + Intergenic
987899062 5:23987492-23987514 GAGAAGAAACAGAGAGAGGCAGG - Intronic
988342489 5:29991486-29991508 GGGTGAAGAGAGAGAGAGGAAGG - Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988544164 5:32141610-32141632 GTGGAAAGAGAGGGAGAGGAGGG - Intronic
989447362 5:41546005-41546027 GCATAAAATCAGAGAGATGAAGG + Intergenic
989781145 5:45265973-45265995 ATATCTAAACAGAGAGAGGAAGG + Intronic
991548288 5:67807888-67807910 GTGGAAAAACAGAGAAGGGGAGG - Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992949929 5:81849043-81849065 GTGCAAAAACTAAGAGATGAAGG - Intergenic
993125160 5:83825486-83825508 GTGTAGAGAGAGAGAGAGGGGGG + Intergenic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
993339681 5:86708000-86708022 TAGGAAAAACATAGAGAGGAGGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993398622 5:87421529-87421551 GTCTAGAAACAAAGAGAGGTGGG + Intergenic
993760732 5:91793572-91793594 GTGTATATATAGAGAGAGGGGGG - Intergenic
993764297 5:91836088-91836110 GTGTATAAAGAGACAGAGGGGGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994470874 5:100204391-100204413 GAGAAAAAACAGAGCCAGGAGGG + Intergenic
994805470 5:104441873-104441895 GTGTTAAAACAGAGTCAAGAAGG + Intergenic
994835136 5:104842110-104842132 GTGTAGAAAGAGAGAGAGGGAGG + Intergenic
994948334 5:106425323-106425345 GTGTAAAAAGAGACAAAGAAGGG - Intergenic
995741042 5:115356016-115356038 GTGTGTAAACAGAGAGGGTAAGG + Intergenic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996671284 5:126120776-126120798 GTGTTCAAACAGAGAAGGGAAGG - Intergenic
996672253 5:126132327-126132349 GAGTAAAACAAGAAAGAGGAGGG + Intergenic
997615278 5:135241986-135242008 GTGGAAGCACAGGGAGAGGAAGG - Intronic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998205265 5:140153122-140153144 ATGAAAAGACAGAGAGCGGAAGG + Intergenic
998688797 5:144562899-144562921 GTGAAAAGACAAAGACAGGAAGG - Intergenic
998722175 5:144965667-144965689 AGGGAAAAACTGAGAGAGGAGGG - Intergenic
998798300 5:145841929-145841951 GTGAAGAAAGAGAGAGACGAAGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000198980 5:158988842-158988864 GTGAAATAACACAGAGAGGAGGG + Intronic
1000992171 5:167922555-167922577 GTGCAAGCACAGAGAGAGGAAGG - Intronic
1001736930 5:174013214-174013236 GAGGAAAGAGAGAGAGAGGAAGG - Intergenic
1002372912 5:178769031-178769053 GAGGAAACACAGAGAGATGAGGG - Intergenic
1002938160 6:1692044-1692066 GTGTAAAAGCAGACATGGGAAGG + Intronic
1003265615 6:4562773-4562795 GTGAAAACACAGGGAGAAGATGG + Intergenic
1003561323 6:7183196-7183218 GGGAAAAAAGAGAGAGAGAAAGG - Intronic
1003709452 6:8573009-8573031 GAGAAAAAAAAAAGAGAGGAAGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004108263 6:12686845-12686867 ATATTAAAACAGAGAGAGGTGGG + Intergenic
1005089182 6:22038452-22038474 ATGTGAGAACAGTGAGAGGAAGG - Intergenic
1005172882 6:23008482-23008504 CTGTAAATTCAGTGAGAGGAAGG - Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005600076 6:27417641-27417663 GTGTAAATAAAGAGATTGGATGG + Intergenic
1005968011 6:30741385-30741407 GAGAAAAAGCAGAGAGAGAAGGG + Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1006564795 6:34946275-34946297 TTGTAAAAAGAGAGAGAGGCCGG - Intronic
1006768202 6:36527777-36527799 GTGTACAAACAGAGCAAAGAAGG + Intronic
1007026010 6:38574948-38574970 GCCTAAACTCAGAGAGAGGACGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007648327 6:43399807-43399829 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1008235805 6:49047968-49047990 GAGAAAATACAGAGACAGGAGGG - Intergenic
1008474888 6:51925789-51925811 AGATAAAAAGAGAGAGAGGAAGG - Intronic
1008506438 6:52235495-52235517 GTGTAAAGAGAGAGAGAGATGGG + Intergenic
1008706488 6:54166551-54166573 GAGGAAAAACAGAGAGACTACGG - Intronic
1008778848 6:55076521-55076543 GTCTAAAAAAAAAGAGAGAAGGG + Intergenic
1008874980 6:56315704-56315726 GTGCAAAAACAGGTAGAGGAGGG - Intronic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009696584 6:67113006-67113028 GAGTAAAAACAGAGATAGAGAGG - Intergenic
1009746183 6:67819500-67819522 GAGGAAAAAGAGAGAGAGGGAGG - Intergenic
1009885458 6:69618844-69618866 GGGTAAAAAGAAAAAGAGGAGGG - Intergenic
1010249160 6:73690852-73690874 GTGGAGAAAGAAAGAGAGGAAGG + Intergenic
1010714944 6:79217814-79217836 GAATAAAAACATAGAAAGGAGGG + Intronic
1011281941 6:85686501-85686523 GGGAAAAAACAGAGAGAACAGGG + Intergenic
1011635741 6:89371484-89371506 GTCTCAAAAAAGAGAGAGAAAGG + Intronic
1011644811 6:89447428-89447450 GTGTAAAGGCTGAGAGAGGTGGG + Intronic
1012592470 6:100999194-100999216 GTGTGAGCACAGAGAGTGGAAGG + Intergenic
1012702215 6:102474105-102474127 GTGCGAATACAGAGAGTGGAGGG + Intergenic
1013299873 6:108794963-108794985 ATGTGAAGACAGAGAAAGGAAGG - Intergenic
1013463855 6:110400162-110400184 GTCTGAAAACACAGAGATGATGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1014490081 6:122052276-122052298 GTGAAAGGATAGAGAGAGGAAGG + Intergenic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1015208173 6:130665797-130665819 GTTTAAAAAAAGAGAGAGAGAGG + Intergenic
1015348724 6:132191637-132191659 AGGTGAAAATAGAGAGAGGAGGG + Intergenic
1016138431 6:140576776-140576798 GAGAAAAAAGAGAGAGAGGATGG - Intergenic
1016216773 6:141613708-141613730 GTCTATAAACAGAGAGTGAAGGG - Intergenic
1016475190 6:144419500-144419522 GTTTAAAAACAGATAGAGGGAGG + Intronic
1016501666 6:144727220-144727242 GATTAAAAACTGAGAGAAGACGG - Intronic
1016720098 6:147286704-147286726 GCGTAAAACCAAAGAGGGGAGGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017883817 6:158581990-158582012 GTGTGAGAACAGAGAGAAGGGGG - Intronic
1017922213 6:158882494-158882516 GTGTAAAAGCAGGAAGAGGCCGG + Intronic
1018267589 6:162041498-162041520 GTTTAGAAAGAGAGAGAGGTGGG - Intronic
1018305739 6:162453310-162453332 AAGGAAAAAGAGAGAGAGGAGGG - Intronic
1018373007 6:163185989-163186011 GGACCAAAACAGAGAGAGGAGGG - Intronic
1018561544 6:165105523-165105545 TGGAAAACACAGAGAGAGGAGGG + Intergenic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020711012 7:11605161-11605183 ATGTACATATAGAGAGAGGAGGG - Intronic
1020816802 7:12915803-12915825 GTGTAAAAAGAGAGATAAAAAGG - Intergenic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1021277227 7:18667000-18667022 AACTAAAAAAAGAGAGAGGAAGG - Intronic
1021387200 7:20045664-20045686 GTGTAACCTGAGAGAGAGGAGGG - Intergenic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1023057973 7:36304851-36304873 GTGAAATAAGGGAGAGAGGAAGG + Intergenic
1023186190 7:37535831-37535853 GTGTAAGAGTAGAGAGAGAAAGG - Intergenic
1023319106 7:38974732-38974754 GTAAGAAAACAGAGAGATGATGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024269831 7:47633971-47633993 GTTTAAAGTCAGAGAGAGGAGGG + Intergenic
1024278864 7:47701471-47701493 GATTAAAAAGAAAGAGAGGAAGG + Intronic
1024482781 7:49882457-49882479 CTGTAAAGAGAAAGAGAGGAAGG + Intronic
1024728932 7:52233286-52233308 GAATAAAAAGAGAAAGAGGATGG + Intergenic
1024742215 7:52366589-52366611 GTGTAGAGACAGAGAGAGACAGG - Intergenic
1026426096 7:70295433-70295455 AGATAAAAACAGAGAGAGAACGG - Intronic
1026459195 7:70598594-70598616 GTTTAAAAAAAGAGGGAGTAGGG + Intronic
1026467495 7:70667003-70667025 GTGGAAAGGCAGAGAGAAGAGGG - Intronic
1026508321 7:71005864-71005886 GGATAGAAACAGACAGAGGAAGG - Intergenic
1026871823 7:73857372-73857394 GTGGCAAACCAAAGAGAGGAGGG + Intergenic
1027252514 7:76408189-76408211 AGGTAAAGCCAGAGAGAGGAGGG - Intronic
1027694625 7:81394805-81394827 ATGGAAAAAAAGAGAGAGGGAGG + Intergenic
1027910868 7:84248748-84248770 TTTTAAAAAGAGAGAGAGGGAGG - Intronic
1028012928 7:85672096-85672118 GAGTAAACAGAGAGAGAGAAAGG + Intergenic
1028381786 7:90208336-90208358 CTGAAAAAAAAGAGAAAGGAAGG + Intronic
1028923546 7:96332518-96332540 GTGTAGAGAGAGAGAGAGGGTGG + Intergenic
1029369295 7:100137880-100137902 TTGCAAAAACTGAGGGAGGAAGG + Intergenic
1029962318 7:104700987-104701009 GTGTAAACAAAGAAAGATGAAGG - Intronic
1030272625 7:107686389-107686411 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1030484327 7:110147868-110147890 GTGTAGAAACAGAAAGTGAATGG + Intergenic
1031652339 7:124305636-124305658 GTCTTAAAAGAGAGAAAGGAGGG - Intergenic
1031789861 7:126088543-126088565 GAGTGAAAAAAGAGAGAGAACGG + Intergenic
1031940928 7:127788168-127788190 GTTTAAAAAAAGAGAGAGAAAGG - Intronic
1032219773 7:129985472-129985494 TTTTAAAAACAGAGACAGGAAGG - Intergenic
1032285106 7:130533818-130533840 GTGTAAGAAAAGGCAGAGGATGG + Intronic
1032364125 7:131283396-131283418 CAGTAAAGAGAGAGAGAGGAAGG - Intronic
1032640842 7:133765827-133765849 GAGTACAAAAAGAGAGAGTAGGG - Intronic
1032798962 7:135302872-135302894 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1033894129 7:146051514-146051536 GGGTAAAAAGAAAAAGAGGAAGG - Intergenic
1033910092 7:146252538-146252560 ATGAGAAAATAGAGAGAGGATGG + Intronic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1036282865 8:7416639-7416661 GGGGACACACAGAGAGAGGAAGG + Intronic
1036338604 8:7894879-7894901 GGGGACACACAGAGAGAGGAAGG - Intronic
1037077402 8:14737665-14737687 ATATGAAAACAGACAGAGGATGG - Intronic
1037417206 8:18664873-18664895 GTGTAACAACAAAGCCAGGATGG + Intronic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1038130422 8:24724405-24724427 ATGTAAAAACAAAGTGTGGATGG + Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1039562350 8:38522801-38522823 GAGAAAGAAGAGAGAGAGGAAGG - Intronic
1041075641 8:54167131-54167153 ATCTAAAAACAGAGAGATAATGG - Intergenic
1041094973 8:54341227-54341249 ATGTAAAACAAGAGAGAAGATGG + Intergenic
1041359039 8:57030865-57030887 GTCTAAAAACAAAGAAAGGCTGG - Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1041829787 8:62141670-62141692 GTTTAACAAAAGAGAGAGGTTGG + Intergenic
1042077370 8:65011050-65011072 GAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1042409607 8:68448045-68448067 GAATAAAAAGAGAGAGAGGTAGG - Intronic
1042760212 8:72264225-72264247 GAGAAAAAACAGAGAGAAAAAGG - Intergenic
1043159481 8:76827809-76827831 GGGTAAAAACAGACAGGGCAGGG + Intronic
1043308019 8:78821253-78821275 ATGTAAGAACAGAAAGAGAAAGG - Intergenic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044375086 8:91460741-91460763 GATTAAACCCAGAGAGAGGAAGG - Intergenic
1044462485 8:92461654-92461676 GTGGAAGAATAGAGAGAGGAGGG - Intergenic
1045113857 8:98960800-98960822 ATGTAGAAAGACAGAGAGGAAGG - Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1046031352 8:108787049-108787071 GAGGAAAAAGAGGGAGAGGACGG - Intronic
1046325022 8:112630671-112630693 GGATAAAAAGAGAGGGAGGAAGG + Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046807207 8:118492552-118492574 GTGAAACAGCAGAGAGAGCATGG - Intronic
1047189726 8:122667118-122667140 GTCAGAAAAGAGAGAGAGGAAGG - Intergenic
1047286358 8:123490605-123490627 GAGAAAAACCAGAGAGAGAATGG - Intergenic
1047561815 8:125994187-125994209 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1047986205 8:130236498-130236520 GTGGAAAAAGTTAGAGAGGAGGG - Intronic
1048214802 8:132484264-132484286 GAGTAAAAAGAGAGAGACAAAGG + Intergenic
1048636541 8:136301880-136301902 GTGCAAAAACAGATAGGAGAGGG - Intergenic
1049029146 8:140020968-140020990 ATGTAAAAACAAAAAGATGAAGG - Intronic
1049862168 8:144906902-144906924 GAGAAAAAAAAGAGAGAGGGAGG - Intergenic
1049939019 9:527117-527139 GTGCAAACACACAGAAAGGAAGG - Intronic
1050099497 9:2103325-2103347 TTGTAAAAACAGACAGCAGACGG + Intronic
1050628196 9:7530060-7530082 GAGTAAAAAGAGAGAGAAAATGG - Intergenic
1050668766 9:7972330-7972352 GCAAAAAAACAGAGAGAAGATGG - Intergenic
1050724652 9:8634468-8634490 GTATATTAACACAGAGAGGAAGG + Intronic
1050738854 9:8796175-8796197 GTTTAAAAACATATAGATGAAGG + Intronic
1050780871 9:9333371-9333393 GAGTAAAGACAGAGAGAGTATGG + Intronic
1051164745 9:14249647-14249669 CTGTAAAAAAATAGAAAGGAAGG + Intronic
1051684816 9:19647031-19647053 GTGTGGAAAGAGAGAGAGAAAGG - Intronic
1051755924 9:20400281-20400303 ATGTGAAAAAAGAGAGATGAGGG + Intronic
1052002707 9:23306256-23306278 GCGGAATAACAGGGAGAGGAGGG + Intergenic
1052079421 9:24185885-24185907 GCATAAAAACTGAAAGAGGAAGG - Intergenic
1052827395 9:33187022-33187044 GTCTAACACCAGAGAGAGGAAGG - Intergenic
1052966575 9:34345011-34345033 AAGTCACAACAGAGAGAGGAGGG + Intergenic
1053169286 9:35867436-35867458 GTGTTAAACAAGAGAGAGAATGG + Intergenic
1053504874 9:38633643-38633665 GTGTAAATACAAATAGGGGATGG + Intergenic
1055108151 9:72533775-72533797 GAGAGAAAAGAGAGAGAGGAAGG - Intronic
1055476584 9:76668959-76668981 GTGAAAACAGAGAGAGAAGATGG - Intronic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056097144 9:83266872-83266894 GGATGAAAAGAGAGAGAGGAAGG - Intronic
1056124751 9:83524229-83524251 TTGTAAAAAGAGAAAAAGGAAGG - Intronic
1056238399 9:84618935-84618957 GTTTAAAAAGAGAGAGAGAAAGG + Intergenic
1056606422 9:88089520-88089542 GTGTACCAACTGAGAGAGGGAGG - Intergenic
1057052153 9:91933662-91933684 GTATAAAAACAAAGAAAGAATGG + Intronic
1057189724 9:93079953-93079975 GTGTATTAAGAGAGAGAGAAAGG - Intronic
1057636840 9:96777117-96777139 TTCTAAAGACAGAGACAGGAGGG + Intronic
1057720004 9:97524534-97524556 GTGTCGAGACAGAGAGAGAAGGG + Intronic
1058930917 9:109717936-109717958 GTGGAAAGAGAGAGAGAGAAAGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059582464 9:115566695-115566717 AAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060038821 9:120282098-120282120 GTGGAAAAACAAAGTGACGATGG + Intergenic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1061281937 9:129602583-129602605 AGGGAAAAACAGAGAGAAGAAGG + Intergenic
1061495370 9:130970963-130970985 GGGCAAAGAGAGAGAGAGGAAGG + Intergenic
1185528796 X:800657-800679 GTGTAAACACTGAGGGATGATGG + Intergenic
1185796076 X:2965597-2965619 GTTTAAAAACATAGAAAAGACGG + Intronic
1186060887 X:5705714-5705736 GAGGAAGAAGAGAGAGAGGAAGG - Intergenic
1186218331 X:7323896-7323918 GTGTAATCACAGAGAGAGGCTGG - Intronic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186827050 X:13350718-13350740 GTGAAACACCAAAGAGAGGAGGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187149443 X:16668596-16668618 AAATAAAAAGAGAGAGAGGAAGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188391521 X:29626634-29626656 TTCTAAAAAGAGAGAGAAGAAGG + Intronic
1188418632 X:29969841-29969863 GTCTTAAAACAGAAAAAGGAAGG + Intergenic
1190933760 X:54974421-54974443 TTGTATAAAGTGAGAGAGGAGGG - Intronic
1190942616 X:55056880-55056902 TTCTAGAAACAGAGAGAGGCAGG + Intergenic
1192190439 X:68988231-68988253 GTAGAAAGAGAGAGAGAGGAAGG + Intergenic
1192420772 X:71028244-71028266 GTGGTAAAATAGAGAGAGGATGG + Intergenic
1193299958 X:79878333-79878355 GTCTAAAATGAGAGAGAAGAGGG + Intergenic
1194760498 X:97790373-97790395 GTTTAAAAATAGAGAGAGAGGGG - Intergenic
1194931473 X:99892895-99892917 ATCTAAAAAGAGAGAGAGAAAGG + Intergenic
1195091569 X:101464429-101464451 ATATTAAAACAGAGAGAGAATGG + Intronic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1196311059 X:114166421-114166443 GTATAAAGACAGAGATAGGTTGG - Intergenic
1196715166 X:118803917-118803939 GAAAAAAAAGAGAGAGAGGAAGG - Intergenic
1197203248 X:123767418-123767440 ATGTAAAAATAGGTAGAGGAAGG - Intergenic
1197217754 X:123882420-123882442 GTGGAAAAACTGTGAGGGGAAGG - Intronic
1198211017 X:134516351-134516373 GTTTAAAAAGAAAGAGAGGCCGG + Intronic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198258973 X:134949620-134949642 ATGTGAAGCCAGAGAGAGGAAGG - Intergenic
1199084681 X:143615221-143615243 GTGTAAAAGCAGAGAGGGGTGGG - Intergenic
1199133075 X:144217610-144217632 GCAAAAAAACAGAGAGAGTAAGG + Intergenic
1199562029 X:149173141-149173163 ATGAAAAAAAAGAGAGAGAATGG - Intergenic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1201299893 Y:12496444-12496466 CTGTAAAGACAGGGAGAAGACGG - Intergenic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic
1201496247 Y:14593761-14593783 GTGAAAAAACACAAAGAGGTGGG - Intronic
1201524725 Y:14919507-14919529 GGTGAAAAACAGAGAAAGGAAGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic