ID: 1035751723

View in Genome Browser
Species Human (GRCh38)
Location 8:2001499-2001521
Sequence GGTTCGGGGGACGGCGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035751723_1035751738 20 Left 1035751723 8:2001499-2001521 CCCGCGGCGCCGTCCCCCGAACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1035751738 8:2001542-2001564 CCGCGTCCCCCGAGGAGCCCGGG 0: 1
1: 1
2: 5
3: 29
4: 187
1035751723_1035751733 12 Left 1035751723 8:2001499-2001521 CCCGCGGCGCCGTCCCCCGAACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1035751733 8:2001534-2001556 TGAGGACCCCGCGTCCCCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
1035751723_1035751739 21 Left 1035751723 8:2001499-2001521 CCCGCGGCGCCGTCCCCCGAACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1035751739 8:2001543-2001565 CGCGTCCCCCGAGGAGCCCGGGG 0: 1
1: 0
2: 2
3: 24
4: 141
1035751723_1035751736 19 Left 1035751723 8:2001499-2001521 CCCGCGGCGCCGTCCCCCGAACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1035751736 8:2001541-2001563 CCCGCGTCCCCCGAGGAGCCCGG 0: 1
1: 0
2: 2
3: 37
4: 205
1035751723_1035751731 -6 Left 1035751723 8:2001499-2001521 CCCGCGGCGCCGTCCCCCGAACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1035751731 8:2001516-2001538 CGAACCGCGCGTTTGGCTTGAGG 0: 1
1: 0
2: 0
3: 0
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035751723 Original CRISPR GGTTCGGGGGACGGCGCCGC GGG (reversed) Exonic
900545335 1:3225826-3225848 GCTCCTGGGGACGGAGCCGCCGG + Intronic
901199173 1:7457050-7457072 GGTGAGGGGCACGGCGGCGCAGG - Intronic
904171038 1:28592419-28592441 GGAGCGGGGGGCGGCGCCGGCGG + Intronic
904181418 1:28669039-28669061 GGGTGGGGGGACGCTGCCGCTGG + Intronic
904252734 1:29236591-29236613 GGCGCGGGGGACGCCGCCCCCGG - Exonic
904399885 1:30249107-30249129 GGTTGGGGGGACGGTGCTGCTGG - Intergenic
904611575 1:31728730-31728752 GGTTGGGGGGAAGGTGCAGCGGG - Intronic
905995904 1:42380604-42380626 GGTTCCGGGGAGCGAGCCGCCGG - Intergenic
915360422 1:155283037-155283059 GGTTCGGGGGATGGGGCCTGGGG + Intronic
918550304 1:185734437-185734459 GATTCGGGCCGCGGCGCCGCAGG + Intergenic
920002805 1:202811160-202811182 GGTTTGGGGGACGGAGGCCCGGG - Intergenic
921171967 1:212558525-212558547 ACTATGGGGGACGGCGCCGCGGG - Intergenic
921909080 1:220528284-220528306 GGATCGGGCGCCGCCGCCGCTGG + Intronic
922757160 1:228102850-228102872 GGTGCCTGGGACGGCGCTGCCGG - Intronic
1065614384 10:27504777-27504799 GGTTCGAGGCAAGGCGCCCCCGG - Intronic
1075522907 10:123154691-123154713 GTTTAGGGGGACGGCGGTGCGGG + Intronic
1076726863 10:132418031-132418053 GGTTGGGGTGACGCCGCCACCGG + Intergenic
1082215322 11:49561108-49561130 GGTTTGGGGGAGGGGGACGCGGG + Intergenic
1082811862 11:57483161-57483183 GGTGCGGGGGGCGGCGACCCGGG - Intergenic
1082959546 11:58905690-58905712 GGTTCGGGGGAGGGGATCGCTGG + Intronic
1083728036 11:64638420-64638442 GGTTCGGGAGACCGCGGGGCTGG + Intronic
1086634249 11:89063370-89063392 GGTTTGGGGGAGGGGGACGCGGG - Intronic
1087673194 11:101129218-101129240 GGGGCGGGGGAGGGCGGCGCTGG + Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090768224 11:129895501-129895523 GGTTAGGGGGCCGGCGCCCGCGG - Intronic
1091550370 12:1531198-1531220 GGCTCCGGGGTCGGCGGCGCAGG + Intronic
1092229123 12:6766983-6767005 GCTGCGGGGGACGGCGCGACCGG - Intronic
1100830940 12:98516099-98516121 GGCTCTGGGGCCGCCGCCGCGGG + Exonic
1105446346 13:20460964-20460986 GGCCCAGGGGAGGGCGCCGCTGG - Intronic
1107447135 13:40479624-40479646 GGCCCAGGGAACGGCGCCGCGGG + Intergenic
1108568281 13:51723766-51723788 GGTATGGAGGACGGCGCTGCAGG - Intronic
1119176106 14:72568633-72568655 GGGTCTGGGGAGGGCGCCTCCGG - Intergenic
1122249653 14:100428904-100428926 GGCTCGGGGGATGACGCCTCTGG - Intronic
1128067769 15:64775320-64775342 GGTGCGGGGGAGGGGGCGGCGGG + Exonic
1130613432 15:85381163-85381185 GGTCCCCGGGTCGGCGCCGCCGG + Intronic
1132645588 16:997903-997925 GGTTCGGGGCGCGGCTCCCCTGG + Intergenic
1133064304 16:3195167-3195189 GGTTGGGGGGAGAGCGCCGGAGG - Intergenic
1136242204 16:28951356-28951378 GGATCCGGGGGAGGCGCCGCTGG + Exonic
1136779018 16:32885631-32885653 GGGCCGGGGGACGGGGCGGCGGG + Intergenic
1136891600 16:33975887-33975909 GGGCCGGGGGACGGGGCGGCGGG - Intergenic
1139480404 16:67227364-67227386 GGCTGGGGGGATGGCGGCGCAGG + Intronic
1139705310 16:68737236-68737258 GGTACGGGGGGCGGTGCCTCCGG + Exonic
1140393384 16:74607195-74607217 GGTTCGCGGGTCGGCGCCGGCGG - Intergenic
1142324070 16:89402815-89402837 GGTTGGGGGGGCGGCACTGCGGG + Intronic
1203081429 16_KI270728v1_random:1147720-1147742 GGGCCGGGGGACGGGGCGGCGGG + Intergenic
1143750046 17:9021467-9021489 GGGGCGGGGGGCGGGGCCGCCGG - Intergenic
1145915367 17:28571007-28571029 GGGTCGGGGGACAGCCCCCCCGG - Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146723907 17:35142218-35142240 GGGGCGGGGGGCGTCGCCGCGGG - Intronic
1147987512 17:44315033-44315055 GGGGCGGGGGACGGGGCCTCGGG + Intronic
1148823203 17:50372978-50373000 GGTTTGAGGGACGGTGTCGCTGG - Intronic
1152632602 17:81417260-81417282 GCTGCGGGGGGCGGCGCCGAGGG + Intronic
1152677357 17:81648401-81648423 GCTTCGGGTGACTTCGCCGCAGG + Exonic
1157279155 18:46334390-46334412 GGGGCGGGGGCGGGCGCCGCGGG + Intronic
1160592293 18:79951397-79951419 GGCTCGGGGGAAGGGGGCGCAGG + Intronic
1160696734 19:488709-488731 GCTGCGGGGGTCGGGGCCGCAGG - Intergenic
1161103561 19:2432904-2432926 GGTCAGGGTGACGGGGCCGCCGG - Intronic
1161103596 19:2433008-2433030 GGTCAGGGTGACGGGGCCGCCGG - Intronic
1161103665 19:2433218-2433240 GGTCAGGGTGACGGGGCCGCCGG - Intronic
1161103700 19:2433323-2433345 GGTCAGGGTGACGGGGCCGCCGG - Intronic
1161103803 19:2433638-2433660 GGTCAGGGTGACGGGGCCGCCGG - Intronic
1162772474 19:12957320-12957342 AGTTCGGGGGAGGGCGGCGAAGG + Intergenic
1163026830 19:14517750-14517772 GGTCCGCGGGGCGGCGCCTCCGG - Intronic
1163804069 19:19385615-19385637 GGTTCTCGGGATCGCGCCGCCGG - Intergenic
1167456157 19:49597477-49597499 GGTTCGGAGGCCGGCGCGGGAGG - Exonic
1167501548 19:49851334-49851356 GGTACGGGGCACGGCGCGGACGG - Exonic
925609845 2:5693340-5693362 GGCTCGGGCGGCGGCGGCGCGGG + Exonic
931292013 2:60881612-60881634 CGTACGGTGGACGGCGACGCTGG + Exonic
931355854 2:61537512-61537534 GGGTCGGGCGGCGGCGCGGCCGG - Intronic
947800977 2:232928338-232928360 GGGTCGGGGCACGGCGGCGCGGG - Intronic
948140611 2:235669947-235669969 GGCTGCGGGGACGGCGCCCCTGG - Intronic
948869502 2:240791230-240791252 GGTTCTGGAGGCGGCGCCACGGG - Intronic
948933618 2:241148960-241148982 GGGTCGGGGGCGCGCGCCGCCGG - Intronic
1169278644 20:4249418-4249440 GGTCCGGGGGGCTGCGGCGCTGG + Intergenic
1172100770 20:32483217-32483239 GGTTCTGGGGAGGGGGGCGCAGG - Intronic
1174576765 20:51542629-51542651 GGGTCCGGGGACGGCGCGCCTGG + Exonic
1176128975 20:63488247-63488269 GGTTCGGAGCGCGGCACCGCCGG + Exonic
1179888740 21:44325528-44325550 GGTTCGGCGGAAGTGGCCGCGGG - Intronic
1182623662 22:31630975-31630997 GGTTGGGCGGACGGCCCAGCAGG - Intronic
1184458265 22:44623654-44623676 GGGTCGGGGGACTGGGCAGCAGG + Intergenic
1184729573 22:46365238-46365260 GGTGCTGTGGACGGCGCCCCTGG + Exonic
949414312 3:3799570-3799592 GGTCCGGAGGAAGGCGCCCCAGG - Exonic
956740560 3:72272442-72272464 GGTTCGGGGCACAGGGCCCCTGG + Intergenic
961827359 3:129606125-129606147 GGCTCGGCGGGCGGCGCGGCGGG + Exonic
968353343 3:198080774-198080796 GGCTCGGGCGCAGGCGCCGCTGG + Intergenic
975666946 4:76741709-76741731 GCCTCGGGGAACGGCGACGCGGG + Exonic
982033612 4:151325212-151325234 GGCGCGGGGGACGGGGCGGCGGG - Intronic
984830294 4:183966524-183966546 GCTTCTGGGGGAGGCGCCGCCGG - Intronic
985550033 5:528293-528315 AGGGCTGGGGACGGCGCCGCAGG + Intergenic
997521183 5:134525502-134525524 GGTTGGGGGGGCGGCGACGGGGG + Intronic
997975744 5:138440430-138440452 GGCTCAGGGGAGGGCCCCGCTGG - Intronic
998156110 5:139788171-139788193 GGTTCGGGGGGGGGCGCGGGGGG - Intergenic
1001506490 5:172284061-172284083 GGTGCGGAGGGCGGCGCCGCGGG - Exonic
1003314949 6:5003782-5003804 GCTTCGCGGGGCGGGGCCGCCGG - Intronic
1020445241 7:8261709-8261731 GGTCCTGGGGCCGGAGCCGCCGG + Intronic
1023846492 7:44123741-44123763 GGCTCGCAGGCCGGCGCCGCGGG + Intronic
1032002160 7:128272312-128272334 GGTTCGGGGGCCGCCGAGGCTGG - Intergenic
1034306252 7:150047572-150047594 GGGGCGGGGGACGGCGGCGGGGG - Intergenic
1034414107 7:150955896-150955918 GCTGCGGGGGAGGGGGCCGCTGG - Intronic
1035331287 7:158098835-158098857 GGGACGGGGAACGGGGCCGCGGG + Intronic
1035637159 8:1155781-1155803 GGTTCGGGGGCAGGTGCTGCAGG + Intergenic
1035751723 8:2001499-2001521 GGTTCGGGGGACGGCGCCGCGGG - Exonic
1036134541 8:6148153-6148175 GGTTCGGGGGAAGGGGGAGCAGG - Intergenic
1039454148 8:37696767-37696789 GTTTCTGGCGATGGCGCCGCGGG - Intronic
1041690417 8:60680464-60680486 GGCTCTGGGGAAGGAGCCGCCGG + Intronic
1049896207 9:113775-113797 AGTGCGCGCGACGGCGCCGCCGG - Intergenic
1059145710 9:111897206-111897228 GGGCCGGGGGATGGCGCTGCTGG + Exonic
1060406125 9:123373899-123373921 GCTTCGGGGGCCCGCGCTGCAGG + Exonic
1060856055 9:126915318-126915340 GGTGCGGGGGGCGGGGCCGGCGG + Intronic
1061052216 9:128203647-128203669 GGGTCGGGGGTCGGCGCCTGGGG - Intronic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1062253490 9:135609696-135609718 GGTTGGGGGGAGGCCGCTGCGGG + Intergenic
1062587034 9:137254090-137254112 GGTGCGGGTGACGGCACCGCAGG - Intergenic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1185431302 X:13546-13568 GGGTCTGGGGATGGCGCCGAGGG - Intergenic
1185431395 X:13801-13823 GGGTCTGGGGATGGCGCCGAGGG - Intergenic
1185440567 X:225943-225965 GGGTCTGGGGATGGCGCCGAGGG - Intergenic
1186349916 X:8731073-8731095 GGTTTGGGGGACGGTTCCCCCGG + Intronic
1187826190 X:23334804-23334826 GGTTCGGGCGGCGGCGGCGGCGG - Exonic
1200100787 X:153688423-153688445 GGGCCGGGGGACGGGGCGGCGGG - Exonic