ID: 1035752000

View in Genome Browser
Species Human (GRCh38)
Location 8:2002716-2002738
Sequence CGGCAGCCGCGGCGAGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035751997_1035752000 -8 Left 1035751997 8:2002701-2002723 CCGCTTCGATCTGAGCGGCAGCC 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG 0: 1
1: 0
2: 4
3: 31
4: 343
1035751995_1035752000 23 Left 1035751995 8:2002670-2002692 CCGACATGGTGGCTCTCGACGGC 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG 0: 1
1: 0
2: 4
3: 31
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752000 Original CRISPR CGGCAGCCGCGGCGAGGCGC AGG Exonic
900203132 1:1420154-1420176 TGGCTGCCGCTGCGGGGCGCGGG - Exonic
900402886 1:2479840-2479862 CGGCAGCCACCGCGAGTCGCTGG + Exonic
900787091 1:4655795-4655817 CGGGGCCCGGGGCGAGGCGCCGG + Intronic
901055967 1:6448748-6448770 CCGCTGCCCCGGCGAGACGCTGG + Exonic
901109616 1:6784857-6784879 CGGCAGCGGCGGCGGGCTGCGGG + Intergenic
901506599 1:9689493-9689515 TGGCAGGCGGGGCGGGGCGCCGG - Intronic
901543390 1:9936839-9936861 ATGCAGCTGCGGCCAGGCGCCGG + Intronic
901577242 1:10210760-10210782 CAGCGGCCGCCGCGAGCCGCAGG - Intergenic
901628910 1:10638833-10638855 CGGAAGCACCGGCGGGGCGCGGG + Exonic
902478428 1:16699891-16699913 CCGCTGCCCCGGCGAGACGCTGG - Intergenic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
902786820 1:18738329-18738351 CGGCAGCCCCGGCCTGGGGCAGG + Intronic
903522158 1:23959289-23959311 AGGGAACCGCGGGGAGGCGCCGG + Intronic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
904652127 1:32013747-32013769 CGGACGCCGCGGCGGTGCGCAGG + Intergenic
904724978 1:32539949-32539971 CGGCCGCCGCGGGGGCGCGCGGG + Intronic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
906522292 1:46474747-46474769 CCGGAGCCGCAGAGAGGCGCAGG + Intergenic
906627043 1:47333886-47333908 CGGCCGGCGCGGCGCGGGGCGGG - Exonic
907440362 1:54474921-54474943 CGGCAGCCCCGCCCGGGCGCAGG + Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
908930585 1:69312492-69312514 CGGCAGCCACAGCGTGGTGCTGG + Intergenic
914053821 1:144153185-144153207 GCGCAGGCGCGGAGAGGCGCTGG + Intergenic
914125325 1:144813180-144813202 GCGCAGGCGCGGAGAGGCGCTGG - Intergenic
915059641 1:153170782-153170804 GGGCAGCCGTGGGGAGGTGCAGG - Intergenic
915367328 1:155323525-155323547 CAGCAGCCGCAGCCCGGCGCCGG - Intronic
915469072 1:156114942-156114964 CGCCACCCGCAGCGGGGCGCAGG + Exonic
916890255 1:169106612-169106634 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
918388761 1:184037053-184037075 GGGCCGCCGCGGCGGGACGCGGG - Intronic
919640306 1:200039540-200039562 CGGCAGCCCCGAGGAGGCGGAGG + Intronic
921029718 1:211326801-211326823 CGGCGGCGGCGGCGAAGCGGAGG - Intronic
921059965 1:211577864-211577886 AGGCAGGGGCGGCGCGGCGCAGG + Intronic
921432800 1:215083021-215083043 CGGCGGCGGCGGGCAGGCGCGGG + Intronic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
922250574 1:223845794-223845816 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
922753533 1:228082154-228082176 CGGCGGCCGCAGTGACGCGCGGG - Intergenic
922958617 1:229626008-229626030 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
923631057 1:235649826-235649848 CGGGAGGCGCGGCGCGGGGCGGG - Exonic
1062829357 10:595128-595150 CTGCAGCAAAGGCGAGGCGCAGG + Intronic
1064981951 10:21174159-21174181 CGGCGGCGGCGGCGAGGCGGGGG - Intronic
1065099926 10:22321960-22321982 TGGCGGCGGCGGCGCGGCGCGGG - Intronic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1066429188 10:35336394-35336416 CGGCGGCCGCGGGGAGGTTCGGG - Intronic
1066429326 10:35336836-35336858 CGGCGGCGGCGGCGACGAGCGGG - Intronic
1068956084 10:62819209-62819231 CGGCAGCTGCGGGGAGGCCAGGG + Intronic
1069024118 10:63521599-63521621 CTGCAGCCGGCGCGAGGCCCAGG + Intronic
1070931194 10:80261637-80261659 GGGCAGCCTGGGCGAAGCGCTGG - Intergenic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1073207148 10:101775418-101775440 GGGCAGCCGCGGCCAGGGGATGG - Intronic
1073535665 10:104274848-104274870 CGGCAGCGGTGGCGAGCCACAGG + Exonic
1074088346 10:110225884-110225906 CGGCAGCCGCGGGCGGGTGCGGG + Intronic
1074503123 10:114043999-114044021 GGGCAGCCGCGGCGCGGGGCCGG - Intergenic
1074503353 10:114044999-114045021 CGGCGGCGGCGGCGGGGCGCGGG - Exonic
1075444626 10:122504866-122504888 GGGCAGCTGCGGGGAGGTGCAGG - Intronic
1075629306 10:123991664-123991686 CGCCAGCCGGGGGGAGGGGCCGG + Intergenic
1075793312 10:125101448-125101470 CCGCAGCCAAGGCGAGGTGCTGG - Intronic
1076722097 10:132397182-132397204 CGGCGGCGGCGGCGGGGCGGGGG + Exonic
1076909207 10:133379070-133379092 GGGGAGGCGCGGGGAGGCGCGGG - Intergenic
1076909211 10:133379080-133379102 GGGGAGGCGCGGGGAGGCGCGGG - Intergenic
1076909215 10:133379090-133379112 GGGGAGGCGCGGGGAGGCGCGGG - Intergenic
1076909261 10:133379180-133379202 GGGGAGGCGCGGGGAGGCGCGGG - Intergenic
1076909316 10:133379328-133379350 CGGCAGCGTCGGGGAGGCCCCGG + Exonic
1077413629 11:2414622-2414644 AGGCAGCCCTGGCGAGGCCCAGG + Intronic
1077514211 11:2992065-2992087 CGGCGGCCGCGGCGGGGCCTGGG - Intronic
1078246117 11:9574182-9574204 CGGCAGCCCCGGCGAGCTGGAGG + Exonic
1079128501 11:17734835-17734857 CGGCAGCAGCGTCGCGGCGGCGG + Exonic
1081699947 11:45146702-45146724 CGCCAGCCTCGGCGCGGCGGCGG - Intronic
1081967177 11:47177067-47177089 CCGCAGCCGGGGCGGGGCGACGG + Exonic
1082076688 11:47980714-47980736 CGGCGGCCGCGGCCACACGCCGG - Exonic
1083656222 11:64230911-64230933 CGGCGGCCGCTCCGAGGAGCCGG - Exonic
1083807569 11:65084163-65084185 CGGCAGCGGAGGCGTGGCCCAGG + Intronic
1083891869 11:65599597-65599619 CTGCAGCCGCCGGGAGGCCCAGG - Exonic
1084069952 11:66727824-66727846 CCGCAGCCCCGGCGACGCGAGGG + Intronic
1084209902 11:67616074-67616096 CGGACGCCGCTGCGGGGCGCAGG + Intergenic
1084522910 11:69675353-69675375 CGGAAGCGGCGGCGCGGGGCAGG + Intronic
1085284503 11:75351305-75351327 CGGCAGCCGCAGAGACGCACGGG - Intronic
1085574419 11:77589751-77589773 GGGGAGGCGCGGGGAGGCGCGGG - Exonic
1089397572 11:118145970-118145992 TGGCAGCCGCGGGGGCGCGCGGG + Intronic
1089557174 11:119320977-119320999 CGGCCGCGGCGGGAAGGCGCCGG + Intronic
1090211055 11:124921327-124921349 GGGCAGCCCCGGCGAGCGGCCGG + Exonic
1090238209 11:125164819-125164841 CGGCGGCGGCGGCGCGGCGGCGG + Intronic
1091616357 12:2053625-2053647 AGGGAGCCCCGGCGAGGCGGCGG - Intronic
1091888093 12:4031311-4031333 CGCCGGGCGCGGGGAGGCGCGGG - Intergenic
1096435793 12:51590763-51590785 CGGGACCCGCCGCGAGACGCTGG - Intronic
1097192314 12:57225407-57225429 CAGCAGCAGCGGCGGGGCCCGGG + Exonic
1097250929 12:57632064-57632086 CAGGAGCCCCAGCGAGGCGCAGG + Exonic
1097787778 12:63780047-63780069 CGGGCGCCGCCGCCAGGCGCCGG + Exonic
1098550375 12:71755144-71755166 CGGCGGCGGCGGCGGGGCGGCGG + Exonic
1102197158 12:111033979-111034001 CGGCGGCGGCGGCGCGGCGGCGG + Intergenic
1102278392 12:111599519-111599541 GGGCGGGCGCGCCGAGGCGCCGG + Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103914976 12:124371571-124371593 CGCCAGCAGCGGCCAGGAGCTGG + Intronic
1106242909 13:27924664-27924686 CGGCCGCCGAGGCGCGACGCTGG - Exonic
1106776695 13:33016371-33016393 GGGCGGGCGCGGCGGGGCGCGGG + Intergenic
1106776713 13:33016448-33016470 CGGGCGGCGCGGCGGGGCGCTGG - Exonic
1107853279 13:44591454-44591476 CGGTTGCCGGTGCGAGGCGCTGG + Intergenic
1110558510 13:76886251-76886273 CGGCGGCGGCGGCGGGGCGCAGG - Exonic
1111125193 13:83906161-83906183 CGGAAGCCTGGGCGAGGCCCTGG - Intergenic
1113493628 13:110712414-110712436 CGGCGGCCGCAGCGGGGCGGAGG + Intronic
1113846381 13:113394044-113394066 CGGGAGCCGCCGGGAGCCGCCGG - Intergenic
1113914735 13:113863601-113863623 GTGCAGCCGCGAGGAGGCGCGGG - Exonic
1114473732 14:22980737-22980759 CGGCTGCCGCCGCGCGGCGGAGG - Intronic
1115610686 14:35046307-35046329 CGGCGGGCTAGGCGAGGCGCGGG + Intronic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1121050493 14:90816459-90816481 CGGCGGGCGCGGCGGGGCCCCGG + Intronic
1121052995 14:90831509-90831531 AGGCAGCAGGGGCGGGGCGCTGG - Intergenic
1121074996 14:91060496-91060518 CGGCAGCGGCTGCGAGGGGACGG - Exonic
1121168833 14:91836343-91836365 CGGCCGCGGCCGCGCGGCGCCGG - Intronic
1121803798 14:96797240-96797262 CGGCATTCCCGGGGAGGCGCGGG + Intergenic
1122081690 14:99271290-99271312 CGGCGGCAGCGGCGCGGCGGCGG - Intronic
1122183493 14:99971981-99972003 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
1122647964 14:103207462-103207484 CGGCAGCCCTGGCGGGGCGCGGG - Intergenic
1122658558 14:103279196-103279218 CGGCAGCCCTGGCGGGGCGCGGG - Intergenic
1122689127 14:103523192-103523214 CCGCGGCGGCGGCGAGGGGCCGG + Intergenic
1122736655 14:103847439-103847461 CGGCAGCTGCGGCGGGCTGCGGG + Exonic
1126592511 15:50354631-50354653 CGGCAGCCCCGGGGTGGCGATGG - Intronic
1126800894 15:52295649-52295671 CGGCAGCCCCGGCCTGGCCCCGG - Exonic
1127439018 15:58987702-58987724 CGGCGGCGGCGGCGAAGCGGCGG + Intronic
1128067698 15:64775103-64775125 GGGCAGCGGCGGGAAGGCGCCGG + Intronic
1128067862 15:64775609-64775631 CGGCAGCGGCGGCGGGGGGCGGG + Intergenic
1128702244 15:69813116-69813138 AGGAAGCCAGGGCGAGGCGCCGG - Intergenic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129752821 15:78077685-78077707 CGGCCGCGGCGCGGAGGCGCAGG - Intronic
1132588185 16:715227-715249 CCGCTGCCCCGGCGGGGCGCGGG - Exonic
1132698172 16:1211110-1211132 TGGCAGCAGCTGCCAGGCGCCGG - Intronic
1132843531 16:1989933-1989955 CGGCCGCGGCGGGGACGCGCGGG - Exonic
1133156545 16:3880396-3880418 CGGCGGCGGCGGCGGGCCGCGGG - Exonic
1133212877 16:4272874-4272896 CGGCGGCGGCGGCGAGGGGAGGG + Exonic
1133346935 16:5077554-5077576 CGGCGGCCTGGGAGAGGCGCGGG + Intronic
1133575684 16:7086985-7087007 CGGCAGCTGCAGCGATGGGCAGG + Intronic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1137665271 16:50246038-50246060 CGGGAGCCGGGGCGGGGGGCTGG - Intergenic
1138507686 16:57486365-57486387 CGCCAGCCGCGCCGTGACGCGGG - Exonic
1138651539 16:58463981-58464003 CGGGAGCCGCGGGGAGGAGGGGG - Intronic
1138686948 16:58734153-58734175 AGGCCGCGGCGGCGAGGCCCGGG + Exonic
1139215171 16:65120760-65120782 AGGCAGGCGCGGCGAGCCCCGGG + Intronic
1139397802 16:66654394-66654416 AGGCAGCAGAGGCGAGGCCCTGG - Intronic
1139402924 16:66696595-66696617 CGGCGGCGGCGGCGATGCGGCGG - Exonic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1140420220 16:74813222-74813244 CCGCAGCCTTGGCGAGGCCCAGG - Intergenic
1140442635 16:74999293-74999315 GGGCGGGCGCGGGGAGGCGCCGG - Exonic
1141608577 16:85169243-85169265 CGGCGGCGGCGGCGGGGCCCGGG - Intergenic
1141989425 16:87602068-87602090 CGGCGGGAGGGGCGAGGCGCGGG + Intronic
1142006025 16:87689944-87689966 CAGCAGCTGGGGCGAGGAGCAGG + Exonic
1142078087 16:88131958-88131980 CAGCAGCCCCGGAGATGCGCGGG - Intergenic
1142638221 17:1270692-1270714 CTGCAGCCGGGGCGAGGCGGAGG + Exonic
1142697701 17:1643076-1643098 AGGTGGCCGCGGCGGGGCGCCGG - Intronic
1143639879 17:8189846-8189868 CGGGAGCCGCAGGGGGGCGCCGG - Exonic
1143783243 17:9240270-9240292 CGGCGGCCGCGCCCAGGCCCAGG - Exonic
1144862556 17:18314794-18314816 CGGCAGCCGGGGAGCGGCTCCGG - Exonic
1146492383 17:33292272-33292294 CGGCAGCGGCGGCGCCGGGCGGG - Exonic
1147637623 17:41973729-41973751 GGGCAGCCGAGGCGAGGAGGTGG + Exonic
1147792494 17:43022179-43022201 CAGCAGTGGCGGCGAGGCGGCGG + Exonic
1148021649 17:44557587-44557609 CGGCAGCCGCAGCGAGGAGGCGG + Exonic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148775850 17:50095422-50095444 CGGCCGCCGCAGCCATGCGCTGG + Exonic
1148836569 17:50468844-50468866 CAGCAGCGGCGGCGGGGCGCGGG + Exonic
1149915039 17:60600670-60600692 CGGCAGCAGCGGCTAGGTGCCGG - Exonic
1150373587 17:64662152-64662174 CGGCGGCCGCGAGGAGGCGGCGG - Intergenic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151828696 17:76537576-76537598 CGGCGGCGGTGGCGGGGCGCGGG + Exonic
1152174924 17:78781605-78781627 CGGCGCCGCCGGCGAGGCGCGGG - Intronic
1152356403 17:79809788-79809810 CGGGGGCCGGGGGGAGGCGCCGG - Intergenic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152714362 17:81891430-81891452 CGGCCGCGGCGGTGGGGCGCAGG - Exonic
1152751808 17:82065744-82065766 CGGCGGCCCCGGCGCGGTGCGGG - Intronic
1153900693 18:9614703-9614725 CGGGAGCCGCGCGGAGGGGCAGG - Intronic
1153935213 18:9914562-9914584 CGCCGGCCGGGGCGAGGCGGAGG + Intronic
1153997484 18:10454693-10454715 CGGCGGCCGGGGCGGGACGCGGG + Exonic
1158976546 18:62715875-62715897 CGGCAGCGGCAGCGGGGCGCGGG + Exonic
1160499718 18:79395750-79395772 CGGCTGCCGCGGCGCGGGGAGGG + Intergenic
1160747643 19:719496-719518 CGGCAGCCGCGCAGAGCCCCTGG - Intronic
1161309360 19:3585551-3585573 CGGCGGCGGCGGCGAGGGCCCGG + Exonic
1161611982 19:5248136-5248158 CGGCACCCACAGCGAGGCACAGG + Intronic
1162954496 19:14090770-14090792 CGGCGGCGGCGGGGAGGGGCCGG - Intronic
1163655669 19:18543528-18543550 CGGCGGCCGCGGCTGGGGGCGGG - Exonic
1165065397 19:33225599-33225621 CGCCACCCGCTCCGAGGCGCCGG + Exonic
1165396218 19:35565039-35565061 GGGCAGCAGCAGCGAGGGGCTGG + Intergenic
1165447150 19:35862605-35862627 CGGGAGCCGGGGCGGGGCTCAGG - Intronic
1165490801 19:36121654-36121676 GGGCAGCCGCTGTGAGGTGCGGG + Exonic
1166042864 19:40213849-40213871 CGGCGGCCGTGGGGACGCGCGGG - Exonic
1166366406 19:42280627-42280649 CGCGGGCCGCGGCGGGGCGCCGG - Intronic
1166533203 19:43554685-43554707 GGGCAGCCGCCGAGAAGCGCTGG - Exonic
1167371539 19:49085583-49085605 CCGCAGCCGCCGCGAGCCTCCGG + Exonic
1168694421 19:58396598-58396620 CGGCGGGGGCGGCGGGGCGCGGG - Exonic
1202693297 1_KI270712v1_random:105843-105865 GCGCAGGCGCGGAGAGGCGCTGG + Intergenic
1202712447 1_KI270714v1_random:25722-25744 CCGCTGCCCCGGCGAGACGCTGG - Intergenic
926980212 2:18560389-18560411 CGGCGGCCGTGGCGCGGCCCAGG + Exonic
927684627 2:25161790-25161812 CGGCAGCCGGGCCGGGGTGCGGG - Intronic
929218115 2:39437105-39437127 CGGCGGCCGCAGCGTGGAGCCGG - Exonic
929218222 2:39437500-39437522 CGGCGGCAGCGGCCGGGCGCGGG - Intergenic
930096404 2:47570130-47570152 CGAGAGCCCCGGCGAGGCGGAGG - Exonic
930641704 2:53859950-53859972 CGGGAGCCGCGGCAAGACGCGGG + Exonic
932621423 2:73266610-73266632 CTGCAGCCGCAGCTTGGCGCTGG + Exonic
933886118 2:86720441-86720463 CGGGAGCAGCGGCGACTCGCCGG + Exonic
933953271 2:87348716-87348738 GCGCAGGCGCGGAGAGGCGCTGG - Intergenic
934237502 2:90245061-90245083 GCGCAGGCGCGGAGAGGCGCTGG - Intergenic
934566975 2:95346592-95346614 CGGCGGCGGCGGCGCGGCGGCGG - Intronic
934966830 2:98731013-98731035 CGGCGGCAGCGGCGGCGCGCGGG - Intronic
935592607 2:104855810-104855832 CGGCGGCGGCGGCGTGGGGCAGG - Exonic
936569839 2:113603745-113603767 GCGCAGGCGCGCCGAGGCGCAGG + Intergenic
936569843 2:113603761-113603783 GCGCAGGCGCGGAGAGGCGCAGG + Intergenic
936569845 2:113603777-113603799 GCGCAGGCGCGCCGAGGCGCAGG + Intergenic
937917360 2:127105778-127105800 CGGCCGCCGGGTGGAGGCGCAGG - Intronic
940751144 2:157628584-157628606 CGGCGGCCGCTGCGAGCAGCAGG + Exonic
940830162 2:158457349-158457371 CCGCGGCGGCCGCGAGGCGCTGG - Intronic
944515729 2:200510021-200510043 CGGCGGCCGCGCCGAGGGTCTGG - Exonic
946326129 2:218985461-218985483 CCGCAGCCGGGGAGACGCGCGGG + Exonic
946688658 2:222295047-222295069 CGGCAGCCTGGGGGAGGCGGAGG - Intronic
946702195 2:222424767-222424789 CGGCAAGGGCGGCGAGGCTCCGG + Exonic
948570110 2:238912552-238912574 CGGCCGCCGCAGGGAGGCCCTGG - Intergenic
948824678 2:240568498-240568520 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
948824696 2:240568535-240568557 CGGCGGCCGCGCCGGGCCGCGGG - Intronic
1169065598 20:2692879-2692901 CGGCCGCGGCGGGGCGGCGCGGG + Exonic
1170888980 20:20363767-20363789 CGGCAGGCGAGGCGGGGTGCAGG + Intergenic
1171439468 20:25148599-25148621 CGGAAGACGCGGCGAGGGTCCGG - Intergenic
1171972544 20:31573210-31573232 CGGCCCCCGCGGGGCGGCGCGGG - Intronic
1172028951 20:31968256-31968278 CGGCGGGCGCGGGGAGGCGGCGG + Exonic
1173494446 20:43508396-43508418 AAGCAGCTGCGGCGAGGGGCGGG + Intronic
1174357827 20:50010110-50010132 CGGCGGCGGCGGCGAGGGGGCGG + Intergenic
1174874019 20:54208318-54208340 GGCCAGCCGAGGCGGGGCGCCGG + Intronic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1176194599 20:63831372-63831394 CCGCGGCCGGGGCGCGGCGCGGG - Intergenic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176550024 21:8217030-8217052 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176591104 21:8651693-8651715 GCGCAGGCGCGGAGAGGCGCAGG - Intergenic
1176705943 21:10120030-10120052 CGGAAGCCGCGTCGAGATGCCGG - Intergenic
1176952660 21:15064937-15064959 AGGAGGCGGCGGCGAGGCGCAGG - Exonic
1179796722 21:43789348-43789370 CCGCAGCCCCAGCGAGGCGCAGG + Intergenic
1180273932 22:10628726-10628748 GCGCAGGCGCGGAGAGGCGCAGG - Intergenic
1180733762 22:18001038-18001060 CAGCAGGCGCGGGGAAGCGCGGG - Intronic
1181147492 22:20859029-20859051 CGGCGGGCGGGGCGAGGCCCTGG + Exonic
1182355357 22:29720289-29720311 CGGCGGCAGCGGCGAGGCTGGGG - Exonic
1183075527 22:35424287-35424309 CGGCAGGAGGGGCGAGGCGTGGG - Exonic
1183441394 22:37825025-37825047 CGGCGGCCGAGGCGCGGCGGAGG + Exonic
1183444413 22:37843854-37843876 GGGCAGCCCGGGCGAGGGGCGGG - Intronic
1184659811 22:45960566-45960588 CGGCAGCCAGGGCCAGGGGCCGG - Intronic
1185270641 22:49928079-49928101 CGGCATCGGCGGGGTGGCGCGGG - Intergenic
1185278861 22:49961386-49961408 CGGCGGCGGCGGCGGGGGGCGGG + Intronic
1203254914 22_KI270733v1_random:133356-133378 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203262970 22_KI270733v1_random:178435-178457 CGGCGGCCGCCGCGGGGCCCCGG + Intergenic
954540624 3:51391241-51391263 CGGGAGCGGCGCCGAGGGGCCGG - Intergenic
954812358 3:53256012-53256034 CGGCTGCCGAGGCCGGGCGCGGG + Exonic
959067819 3:101676335-101676357 GGCCAGCCGCGGGGAGGGGCCGG - Intronic
960582747 3:119294689-119294711 CGGCGGCCCCGGAGCGGCGCGGG + Exonic
960937604 3:122913114-122913136 CGGGAGCCCCGGGGAGGCCCAGG - Intronic
961536683 3:127575147-127575169 CGGCAGCCACGCGGGGGCGCCGG + Intronic
962277951 3:134030031-134030053 CGGCGGCGGCGGCGGGGCGGGGG - Exonic
966849342 3:184155287-184155309 CGGCCGCCGCGGAGAGGCGCCGG - Intronic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
969597830 4:8158892-8158914 CGGCAGCGGGGGCGCGGGGCGGG - Intergenic
972162570 4:36244485-36244507 CGGCGGCCGAGGCGAGGCGCGGG - Exonic
974047163 4:56907989-56908011 CGGCAGCCGCCGCCAGGGTCTGG - Exonic
975541294 4:75514599-75514621 CGGCAGCGGCGCGGAGACGCTGG + Exonic
975870832 4:78776579-78776601 CGGCAGCGGCGGCGGAGCGGCGG + Exonic
979251470 4:118571075-118571097 CGGCAGCAGAGGGGAGGTGCTGG + Intergenic
980677074 4:136099231-136099253 CGCCAGCAGCGGCAACGCGCTGG - Intergenic
981504108 4:145481723-145481745 CGGCAGCGGCGGCGGCGCGCGGG + Intronic
981550519 4:145937493-145937515 CGGGAGCTGCGCCGAGGCGAAGG - Intronic
981920474 4:150079470-150079492 CGGCAGGTGCGGCGGAGCGCCGG + Intronic
984462990 4:180059156-180059178 CCGCCGCCGCGGCCGGGCGCAGG - Intergenic
984667997 4:182448829-182448851 CGGCGGCCGAGCCGGGGCGCTGG + Intronic
984734825 4:183099233-183099255 AGGCAGCGGCGGCGAGGGGGAGG + Intergenic
984876401 4:184371683-184371705 CGGCATCCCTGGCCAGGCGCAGG + Intergenic
989480526 5:41925476-41925498 CGGCAGCCGCGTCAGGGTGCTGG - Exonic
989812569 5:45695862-45695884 CGGCGGCGGCGGCGAGGAGCCGG - Exonic
989812708 5:45696393-45696415 GGGCAGCCGAGGGGAGGCGCTGG - Intergenic
990041563 5:51383435-51383457 CGGCAGACTCGGCGCGGCTCGGG - Exonic
990165374 5:52988931-52988953 CGGCACCCGCTGCCAGGAGCCGG + Intergenic
992105871 5:73448495-73448517 CGGCAGCCCCGGCGCAGCTCCGG - Intergenic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
994353834 5:98773857-98773879 CGGCGGCAGCAGCGGGGCGCAGG - Intronic
998130618 5:139649529-139649551 GGGCAGCGGGGGCGAGGAGCCGG - Intronic
999300241 5:150486240-150486262 CGGCGGCGGCGGCGTGGAGCGGG + Intronic
1002512759 5:179733379-179733401 CGTCAGCGGCGTCCAGGCGCGGG - Exonic
1002524406 5:179807152-179807174 CCGCAGCCGGGGCGGGGGGCGGG + Intronic
1003948228 6:11094202-11094224 CGCCAGGCGCGGCTGGGCGCCGG - Exonic
1003995809 6:11538210-11538232 CGGCGGCGGCTGCGAGGCTCGGG - Intergenic
1004561924 6:16760405-16760427 CGGCAGCCGCCGCCCGGAGCCGG - Intronic
1004650179 6:17600574-17600596 CGGCGGCAGCCGCGAGGCCCGGG - Exonic
1006313407 6:33277127-33277149 CGGCCGCCGGGGCGAGGCGGGGG + Exonic
1006458333 6:34144407-34144429 CGGCGGCCGCGTAGACGCGCAGG + Intronic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1006606212 6:35259597-35259619 TGGCTGCCGCGGCGAAGCGGGGG + Intronic
1006640429 6:35486614-35486636 CAGCAGCCCCGGGGAGGCCCGGG - Exonic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1007901993 6:45421781-45421803 CGGCAGCGGCTGCGATTCGCAGG + Intronic
1011044372 6:83065812-83065834 CGGCAGCCCCGCTGCGGCGCAGG + Exonic
1014272492 6:119349660-119349682 CCGCAGCCCCGGCGCGGCTCAGG + Exonic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1016010835 6:139135791-139135813 GGGCAGCCGCGGCGGGGCGGAGG - Intronic
1016949444 6:149566253-149566275 GGGCGGCCGCGGAGAGGCGCGGG - Intergenic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1018774212 6:166998863-166998885 CTGCAGCCCCGGGGGGGCGCCGG - Intergenic
1020383091 7:7567116-7567138 CCGCGGCCGCAGCGAGGGGCCGG + Intronic
1021827989 7:24573556-24573578 CGGCAGCGGCGGCGCGGAGGCGG + Exonic
1022275795 7:28854300-28854322 CGGCAGGTGCGGCGACGCCCAGG - Intergenic
1022721196 7:32943024-32943046 CGGCACCTGCGGCGCGGCTCTGG + Intergenic
1023937296 7:44748953-44748975 GGGCCGCCACGGCGAGGGGCCGG + Exonic
1028148559 7:87345729-87345751 CGGCAGAGGCGGCGAGGCGCGGG + Exonic
1028417578 7:90596342-90596364 GGGCGGCGGCGGCGCGGCGCGGG + Intronic
1029168934 7:98617446-98617468 CGGCAGCGGCGGCGGGATGCTGG + Exonic
1029553559 7:101252041-101252063 CCGCAGGCTCGGCGAGGCTCGGG + Intronic
1030138698 7:106284561-106284583 CGGCGGCGGCGGCGCGGCGGGGG - Intronic
1030138855 7:106285051-106285073 CGGGAGCCGTGACGCGGCGCGGG + Exonic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1030884754 7:114922995-114923017 AGGCGGCAGCGGCGCGGCGCGGG + Exonic
1031992850 7:128209262-128209284 CTGCAGCCGCGGTGAGGCCACGG + Intergenic
1033300043 7:140177185-140177207 CGGCCGTCGCGGAGAGGAGCGGG - Intergenic
1033306711 7:140230757-140230779 CAGCAGCCGCGGCAGGGCACGGG - Intergenic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034174620 7:149090811-149090833 CGGCAGCCGCGGCCGGGCGCCGG - Intergenic
1034339373 7:150341827-150341849 CTGCAGCCGCGGCCAGGGTCAGG - Intergenic
1034445933 7:151114525-151114547 CGGGAACGGCGGCGCGGCGCGGG - Intronic
1035581040 8:738986-739008 CGGCGGCGGCGGCGTCGCGCAGG - Intergenic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1036561570 8:9903855-9903877 CTGCAGGGGAGGCGAGGCGCGGG - Intergenic
1038509641 8:28119764-28119786 CGGCTGCCTCTGGGAGGCGCAGG - Intronic
1038883599 8:31640055-31640077 CGGCAGCGGCGGCGACGAGCGGG - Intronic
1039476484 8:37841704-37841726 CGGCAGCAGCGGCCATCCGCTGG + Exonic
1039921464 8:41896791-41896813 CGGCGGCGGCGGCGAAGCGGGGG + Intergenic
1040806850 8:51405075-51405097 CGGCAGCCCCGGCCAGCCACTGG + Intronic
1041919831 8:63168975-63168997 CGGCAGCGGCGGCGACGGGGAGG - Intronic
1042316999 8:67435503-67435525 CGGCAGGTGCGGGGAGGCTCCGG + Intronic
1045032889 8:98154369-98154391 AGGCAGCTGCTGCGAGCCGCAGG + Intronic
1045231186 8:100309438-100309460 CGGTTGCCGCGGGGAGGCGGCGG - Intronic
1048980911 8:139703141-139703163 CAGCAGCAGCGGGGAGGCGGGGG + Intergenic
1049541510 8:143211239-143211261 CGGTAGCCGGGGCGGGGCGCGGG + Intergenic
1049585444 8:143430642-143430664 CGGCGGCCGCGGGGAGGAGGCGG - Intergenic
1049620904 8:143597931-143597953 CGGCGGCCGCGGCGCGGTACCGG - Exonic
1049746815 8:144266515-144266537 GGCCGGCCGGGGCGAGGCGCGGG - Intronic
1050512981 9:6413767-6413789 GGGCAGCCCCCGCGAGGCGCGGG + Intronic
1050744092 9:8857550-8857572 CGGCAGCCGGAGCCGGGCGCAGG + Intronic
1051289114 9:15527709-15527731 CGGCGGCTGCTGCGCGGCGCTGG + Intergenic
1052362191 9:27573365-27573387 CGGCTGCCGGGAAGAGGCGCGGG - Intronic
1053643223 9:40107148-40107170 CGGAAGCCGCGTCGAGATGCCGG - Intergenic
1053690424 9:40584147-40584169 GCGCAGGCGCGGAGAGGCGCAGG - Intergenic
1054274365 9:63053260-63053282 GCGCAGGCGCGGAGAGGCGCAGG + Intergenic
1054301676 9:63385108-63385130 GCGCAGGCGCGGAGAGGCGCAGG - Intergenic
1054324076 9:63704376-63704398 CGGAAGCCGCGTCGAGATGCCGG - Intergenic
1054400459 9:64711669-64711691 GCGCAGGCGCGGAGAGGCGCAGG - Intergenic
1054434049 9:65195925-65195947 GCGCAGGCGCGGAGAGGCGCAGG - Intergenic
1054496338 9:65825743-65825765 GCGCAGGCGCGGAGAGGCGCAGG + Intergenic
1054541532 9:66269455-66269477 CGGAAGCCGCGTCGAGATGCCGG + Intergenic
1056333232 9:85539302-85539324 CGGCAGCCCCGGCAATGCTCAGG + Intergenic
1056386191 9:86099282-86099304 CGCAAGCCGCGGGGAGGCTCCGG + Intronic
1057259664 9:93576666-93576688 CGGCGGGGGCGGCGGGGCGCAGG - Exonic
1057623323 9:96655398-96655420 CGGTTTCCGCGGCGCGGCGCGGG + Intergenic
1058967149 9:110048785-110048807 AGGCAGCGGCCGCGCGGCGCTGG + Exonic
1059145530 9:111896599-111896621 CGGCAGCGGGAGCGAGGAGCCGG + Intergenic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1060278094 9:122197499-122197521 GGGGAGCCGCAGAGAGGCGCAGG + Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061623102 9:131824374-131824396 GGGGAGCCGCGGGGAGCCGCAGG + Intergenic
1062230380 9:135479225-135479247 GGGCAGCCGCGGGGACACGCGGG + Intronic
1062230608 9:135479821-135479843 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
1062314774 9:135961272-135961294 CGGGAGCCGGGGCGGGGCGGCGG - Exonic
1062556350 9:137114865-137114887 GGGCAGCGGCCGCGGGGCGCGGG - Intronic
1062574569 9:137200226-137200248 CGGCGGCGGCGGCGGGGGGCGGG + Exonic
1202790977 9_KI270719v1_random:90118-90140 CGGAAGCCGCGTCGAGATGCCGG - Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1185492307 X:526943-526965 GGGCAGCCGCAGAGAGGTGCAGG + Intergenic
1189310042 X:40012496-40012518 CGGCCGGCGCGGCGCGGCGCGGG + Intergenic
1189324599 X:40105106-40105128 CGGCGGCGGCGGCGAGGAGGGGG + Intronic
1190285231 X:48957219-48957241 CGGCGGTCCCGGCGACGCGCTGG - Exonic
1192504005 X:71670010-71670032 CGGCAGCCACAGCCAGGCCCTGG - Intergenic
1192509969 X:71715875-71715897 CGGCAGCCACAGCCAGGCCCTGG + Intronic
1192516728 X:71765678-71765700 CGGCAGCCACAGCCAGGCCCTGG - Intronic
1192529102 X:71870999-71871021 CGGCAGCCACAGCCAGGCCCTGG + Intergenic
1195668349 X:107449915-107449937 CGGCAGCGGCGGCGCAGCGGCGG - Intergenic
1200216693 X:154371276-154371298 CTGCAGCCTCGGCGAGGGGACGG + Exonic
1200277774 X:154750875-154750897 GGGCGGCCGCGGGGAGCCGCTGG - Intronic