ID: 1035752065

View in Genome Browser
Species Human (GRCh38)
Location 8:2002950-2002972
Sequence GCGCCTCGAAGCCGCCGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752065_1035752068 -8 Left 1035752065 8:2002950-2002972 CCAGGGCGGCGGCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1035752068 8:2002965-2002987 CGAGGCGCTGGGCGCCCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 127
1035752065_1035752069 0 Left 1035752065 8:2002950-2002972 CCAGGGCGGCGGCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1035752069 8:2002973-2002995 TGGGCGCCCCCTTGGACGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 31
1035752065_1035752071 2 Left 1035752065 8:2002950-2002972 CCAGGGCGGCGGCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1035752071 8:2002975-2002997 GGCGCCCCCTTGGACGTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1035752065_1035752070 1 Left 1035752065 8:2002950-2002972 CCAGGGCGGCGGCTTCGAGGCGC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1035752070 8:2002974-2002996 GGGCGCCCCCTTGGACGTCCGGG 0: 1
1: 0
2: 1
3: 2
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752065 Original CRISPR GCGCCTCGAAGCCGCCGCCC TGG (reversed) Exonic
900226466 1:1535562-1535584 GTGCCTCGTGCCCGCCGCCCGGG - Intronic
901064013 1:6486153-6486175 CCGCCTCGGAGCCTCAGCCCAGG + Intronic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
913222110 1:116667805-116667827 TCTCTTCGAGGCCGCCGCCCTGG - Intergenic
915605035 1:156945054-156945076 ACGCCTGGATGCCACCGCCCTGG - Exonic
916057720 1:161079611-161079633 GCGCCTGGAAGCTGCCGGCGGGG + Exonic
916785697 1:168085617-168085639 GGCCCCCGAAGCCGCCCCCCGGG + Exonic
921152770 1:212414913-212414935 GCGCCTGGCCGCTGCCGCCCAGG + Intergenic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
1064443006 10:15370737-15370759 GGCCCCCGAAGCCTCCGCCCGGG + Intronic
1065110628 10:22436843-22436865 GCGCCTCGGAGTAGCCGCCGCGG - Intronic
1067560257 10:47300313-47300335 GCCCCTCGAAGCAGCCGGGCCGG + Intergenic
1067705743 10:48605250-48605272 GCGCCTTTCAGCCGCCGCCTGGG + Intronic
1068762901 10:60733051-60733073 GCGCCTGGAAGTTGCGGCCCGGG - Intronic
1072193723 10:93097096-93097118 GCGCCTGGAAGCTGCAGGCCTGG + Intergenic
1076333915 10:129692290-129692312 CTGCCTGGAAGCCGCCGCTCAGG - Intronic
1077038368 11:506493-506515 GGGCCGCGAAGCTGCCGCCTGGG - Intronic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1077637854 11:3855656-3855678 CCGCCTGGAAGCCGCTGTCCTGG + Intronic
1078594456 11:12674584-12674606 GTGCCTGGACGCGGCCGCCCCGG - Exonic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1081871737 11:46385778-46385800 GCGTCAAGAAGCCCCCGCCCGGG - Exonic
1083458036 11:62791974-62791996 TCGCCTCCAAGGCGCCGCCATGG + Exonic
1091564837 12:1640659-1640681 GGGCCCAGAAGCTGCCGCCCAGG - Intronic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1099437268 12:82659521-82659543 GGGCCTCCAAGCCCACGCCCCGG + Intergenic
1104090117 12:125509290-125509312 GCGCCAGGAAGCCCCGGCCCAGG - Intronic
1104832836 12:131766137-131766159 TCGCCTCGCAGCTGCTGCCCGGG + Exonic
1108292495 13:48975812-48975834 CCGCCTCGAGCCCGCCGCGCCGG - Intergenic
1112733638 13:102394479-102394501 GCGGCCGGAAGCCGCCGCGCGGG - Intronic
1114513995 14:23285923-23285945 GAGGCTGGGAGCCGCCGCCCGGG - Exonic
1117424428 14:55580278-55580300 GCGCCTCGGAGCGGGCGGCCCGG + Intronic
1120789233 14:88563521-88563543 GCTCCTCCCAGCCCCCGCCCGGG + Intronic
1122624231 14:103075886-103075908 GCGCCCCGCAGCCGCGCCCCGGG + Intergenic
1122648014 14:103207687-103207709 GCACCGCGAAGCCGTCGCCGTGG - Intergenic
1123026124 14:105425082-105425104 GCTCCCCCAAGCCGCCTCCCGGG - Intronic
1131186037 15:90275046-90275068 GCGACTCCCAGCCGCCGCCCGGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132815867 16:1826373-1826395 GCGCCTCAGAGCCGCGCCCCAGG + Intronic
1137426559 16:48385348-48385370 GCGCCCCGCAACGGCCGCCCCGG + Intronic
1140504545 16:75463493-75463515 GCGCCTGGCAGTCGCTGCCCAGG + Intronic
1141730699 16:85821130-85821152 GCGCCTTGAAACAGTCGCCCAGG - Intergenic
1142271786 16:89093776-89093798 GCGCCCGGAACCCGCCGCCACGG + Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147791575 17:43017087-43017109 GAGCCTAGAACCCGCCTCCCGGG - Intronic
1152586825 17:81192990-81193012 GCCCCTCAAAGCCACCGCCCGGG + Intronic
1152680830 17:81666948-81666970 ACGCCTTGAAGGCTCCGCCCGGG + Intronic
1153457596 18:5296519-5296541 GCGTCTCGGAGCGGGCGCCCCGG + Intronic
1158938356 18:62384953-62384975 GCCCCTCGGGGCCGCCGCACGGG - Exonic
1160543624 18:79638651-79638673 GCAGCTCGGAGCCGTCGCCCTGG + Intergenic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1161038032 19:2096299-2096321 CCGCCTCGCAGCCGCCGCGGAGG + Exonic
1161646419 19:5456016-5456038 CCGCCTCGAAGCCGGCGCGCTGG - Exonic
1162401862 19:10451271-10451293 AAGCCTTGAAGCTGCCGCCCAGG - Intronic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1163829288 19:19540157-19540179 GGGCCTACAGGCCGCCGCCCTGG + Intronic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1167738764 19:51311880-51311902 GCTTCTCGCCGCCGCCGCCCTGG + Exonic
925959853 2:9004051-9004073 GCGCCTCGGCGCCCTCGCCCGGG - Intergenic
927212638 2:20648067-20648089 GGGCCTCGGAGCCGCTGCCCTGG - Intronic
927809400 2:26173191-26173213 GCGCCCCGGGGCCGCCGTCCCGG - Exonic
934618524 2:95790073-95790095 GCGCCCCACAGCCCCCGCCCAGG - Intergenic
934642369 2:96034486-96034508 GCGCCCCACAGCCCCCGCCCAGG + Intronic
935137629 2:100321721-100321743 GCGCCTCGGGCTCGCCGCCCGGG + Exonic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
946386878 2:219388581-219388603 GCGACCCGCAGCCGCCGCCAGGG + Intronic
946422214 2:219571303-219571325 GCGCCCCGACCCCGCCGCCCCGG - Intronic
946921382 2:224585024-224585046 GCGACCTGAAGCCGCCGCCGGGG - Exonic
1172209255 20:33185554-33185576 GCGCCTCTGCCCCGCCGCCCCGG - Intergenic
1172284735 20:33732392-33732414 GCGCCGCCAAGCCGCCTCCCTGG - Intronic
1174357784 20:50009965-50009987 GCCCCTCCAGGCCGCGGCCCCGG + Intergenic
1175479442 20:59300917-59300939 GCGCCTCGGGTCCCCCGCCCTGG - Intronic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180876649 22:19178070-19178092 GGCCCTCGGTGCCGCCGCCCTGG + Intronic
1181085145 22:20436435-20436457 TCGCATCGATGCCGCCGCCGCGG - Intronic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1183744819 22:39686222-39686244 CCGCCCCCACGCCGCCGCCCTGG + Exonic
1183985440 22:41567591-41567613 GCTCCTCCAAGCCCACGCCCTGG + Intronic
1184243402 22:43223252-43223274 GCTCCAGGAAGCCTCCGCCCTGG - Intronic
1184442097 22:44523206-44523228 GTGCTTCGAAGCAGCCGCCCAGG + Intergenic
949522369 3:4868660-4868682 ACGCGGCGAAGCCGGCGCCCCGG - Intronic
954779007 3:53045763-53045785 GCCCCTCCAGGCCGCCGCGCGGG + Intronic
960973655 3:123156321-123156343 GTGCCTCAAAGCCGCAGCCAGGG - Intronic
961356598 3:126343526-126343548 GAGCCTCGAACCCGCGTCCCTGG - Exonic
968309938 3:197675029-197675051 GGCCCTGGAAGCCGCCGTCCTGG - Exonic
968512914 4:1003218-1003240 CCGCCTCGGAGCCCCCGCCCCGG - Intronic
968542520 4:1175320-1175342 GAGCCTGGAAGCCGCTGCCACGG - Intronic
968902486 4:3438198-3438220 GCGCCTCAAGGCCTCCACCCTGG + Intronic
971244084 4:24912928-24912950 TCGCGTCGCCGCCGCCGCCCGGG + Intronic
973993786 4:56436432-56436454 GCGCCTCTAGGCAGCCGCGCGGG + Intronic
983218176 4:165020267-165020289 GCGCCTCTGCCCCGCCGCCCCGG - Intergenic
985895498 5:2748351-2748373 TGGGCTCGTAGCCGCCGCCCGGG + Exonic
990581804 5:57173510-57173532 GCGCCGGGAAGCGGCCGCGCAGG - Intergenic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
1001577244 5:172772128-172772150 GCGACTCGACGGCGCCCCCCAGG + Intergenic
1002898086 6:1390613-1390635 GCGCCTGGAAGTCGAAGCCCTGG - Exonic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1005322288 6:24667018-24667040 GCGCTTCGCACCCACCGCCCCGG - Exonic
1006834170 6:36986510-36986532 GCGCTTCCAAGCCACCTCCCTGG + Intergenic
1007609344 6:43139228-43139250 GCGCCTCGATGCTGCCGGCTGGG - Exonic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1016658006 6:146543542-146543564 GGGCTTCGGAGGCGCCGCCCGGG + Intergenic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1018915152 6:168128515-168128537 GCTCCTCTAAGCAGCAGCCCAGG + Intergenic
1019305519 7:332693-332715 GCGCCTCCAAGCCTCTCCCCAGG - Intergenic
1019453652 7:1113368-1113390 GCTCCCAGAAGGCGCCGCCCGGG + Intronic
1019735165 7:2646861-2646883 GCTCCTGGGGGCCGCCGCCCTGG + Exonic
1025777298 7:64570383-64570405 GCTTCTCGCCGCCGCCGCCCTGG - Intergenic
1027051585 7:75024713-75024735 GCTCCTCCCTGCCGCCGCCCGGG + Exonic
1029675210 7:102064002-102064024 CCGCCTGGAAGGCGCCTCCCAGG - Intronic
1030121132 7:106112018-106112040 GGGCTTTGAGGCCGCCGCCCCGG - Intronic
1034983698 7:155494658-155494680 CCGCCCCGAACCCGCCGCCCAGG - Intronic
1035401697 7:158570086-158570108 GCCCCGAGAAGCCGCCGCGCCGG + Intronic
1035752065 8:2002950-2002972 GCGCCTCGAAGCCGCCGCCCTGG - Exonic
1036910582 8:12754709-12754731 GCGCCTCGCAGGCGGCGGCCAGG + Exonic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1048550297 8:135427540-135427562 GCGCCTCTCAGCCGCCGGCATGG + Intergenic
1049611090 8:143555654-143555676 GCCCCTGGAAGCCAGCGCCCTGG - Intronic
1052757113 9:32552352-32552374 GCGCCTGGCAGCCACCGCCTGGG + Intronic
1054781957 9:69174072-69174094 GAGCCTCGAAGGCGCGGCGCCGG + Intronic
1060970590 9:127735253-127735275 GCGCGTCGCAGCCGCCATCCGGG + Exonic
1062314821 9:135961443-135961465 GCGCCTCGCTCCCGCCGCCGGGG + Intergenic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1062636371 9:137493709-137493731 GCGCCTCGGAGCAGGAGCCCTGG - Intronic
1199595850 X:149505251-149505273 GCGCAACACAGCCGCCGCCCGGG + Intronic
1200155351 X:153972073-153972095 GAGCCTCCACGCCTCCGCCCTGG + Intergenic