ID: 1035752216

View in Genome Browser
Species Human (GRCh38)
Location 8:2003684-2003706
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752216_1035752227 25 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752216_1035752225 23 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1035752216_1035752226 24 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752226 8:2003731-2003753 CGTCTCACTGTTGGACCGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 42
1035752216_1035752223 22 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752223 8:2003729-2003751 TCCGTCTCACTGTTGGACCGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1035752216_1035752222 15 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752222 8:2003722-2003744 GAGCAGCTCCGTCTCACTGTTGG 0: 1
1: 0
2: 2
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752216 Original CRISPR GAGTAGCAATGGTGTGGGGA AGG (reversed) Exonic