ID: 1035752219

View in Genome Browser
Species Human (GRCh38)
Location 8:2003690-2003712
Sequence GAGTTTGAGTAGCAATGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752219_1035752222 9 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752222 8:2003722-2003744 GAGCAGCTCCGTCTCACTGTTGG 0: 1
1: 0
2: 2
3: 10
4: 108
1035752219_1035752226 18 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752226 8:2003731-2003753 CGTCTCACTGTTGGACCGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 42
1035752219_1035752227 19 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752219_1035752223 16 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752223 8:2003729-2003751 TCCGTCTCACTGTTGGACCGAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1035752219_1035752225 17 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752219 Original CRISPR GAGTTTGAGTAGCAATGGTG TGG (reversed) Exonic