ID: 1035752221

View in Genome Browser
Species Human (GRCh38)
Location 8:2003718-2003740
Sequence CAGTGAGACGGAGCTGCTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752221_1035752229 14 Left 1035752221 8:2003718-2003740 CCTAGAGCAGCTCCGTCTCACTG 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1035752229 8:2003755-2003777 CTTTCATATTTTCAGTTGAAAGG 0: 1
1: 0
2: 3
3: 42
4: 452
1035752221_1035752227 -9 Left 1035752221 8:2003718-2003740 CCTAGAGCAGCTCCGTCTCACTG 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752221_1035752226 -10 Left 1035752221 8:2003718-2003740 CCTAGAGCAGCTCCGTCTCACTG 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1035752226 8:2003731-2003753 CGTCTCACTGTTGGACCGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752221 Original CRISPR CAGTGAGACGGAGCTGCTCT AGG (reversed) Exonic