ID: 1035752225

View in Genome Browser
Species Human (GRCh38)
Location 8:2003730-2003752
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752220_1035752225 12 Left 1035752220 8:2003695-2003717 CCATTGCTACTCAAACTCACATG 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1035752217_1035752225 19 Left 1035752217 8:2003688-2003710 CCCCACACCATTGCTACTCAAAC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1035752216_1035752225 23 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1035752218_1035752225 18 Left 1035752218 8:2003689-2003711 CCCACACCATTGCTACTCAAACT 0: 1
1: 0
2: 4
3: 41
4: 333
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1035752219_1035752225 17 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752225 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type