ID: 1035752227

View in Genome Browser
Species Human (GRCh38)
Location 8:2003732-2003754
Sequence GTCTCACTGTTGGACCGAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752218_1035752227 20 Left 1035752218 8:2003689-2003711 CCCACACCATTGCTACTCAAACT 0: 1
1: 0
2: 4
3: 41
4: 333
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752221_1035752227 -9 Left 1035752221 8:2003718-2003740 CCTAGAGCAGCTCCGTCTCACTG 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752219_1035752227 19 Left 1035752219 8:2003690-2003712 CCACACCATTGCTACTCAAACTC 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752220_1035752227 14 Left 1035752220 8:2003695-2003717 CCATTGCTACTCAAACTCACATG 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752216_1035752227 25 Left 1035752216 8:2003684-2003706 CCTTCCCCACACCATTGCTACTC 0: 1
1: 0
2: 2
3: 27
4: 301
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96
1035752217_1035752227 21 Left 1035752217 8:2003688-2003710 CCCCACACCATTGCTACTCAAAC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1035752227 8:2003732-2003754 GTCTCACTGTTGGACCGAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752227 Original CRISPR GTCTCACTGTTGGACCGAGG GGG Exonic