ID: 1035752229

View in Genome Browser
Species Human (GRCh38)
Location 8:2003755-2003777
Sequence CTTTCATATTTTCAGTTGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035752224_1035752229 2 Left 1035752224 8:2003730-2003752 CCGTCTCACTGTTGGACCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1035752229 8:2003755-2003777 CTTTCATATTTTCAGTTGAAAGG 0: 1
1: 0
2: 3
3: 42
4: 452
1035752221_1035752229 14 Left 1035752221 8:2003718-2003740 CCTAGAGCAGCTCCGTCTCACTG 0: 1
1: 0
2: 2
3: 11
4: 180
Right 1035752229 8:2003755-2003777 CTTTCATATTTTCAGTTGAAAGG 0: 1
1: 0
2: 3
3: 42
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035752229 Original CRISPR CTTTCATATTTTCAGTTGAA AGG Exonic