ID: 1035752229 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:2003755-2003777 |
| Sequence | CTTTCATATTTTCAGTTGAA AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 498 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 42, 4: 452} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035752224_1035752229 | 2 | Left | 1035752224 | 8:2003730-2003752 | CCGTCTCACTGTTGGACCGAGGG | 0: 1 1: 0 2: 0 3: 5 4: 91 |
||
| Right | 1035752229 | 8:2003755-2003777 | CTTTCATATTTTCAGTTGAAAGG | 0: 1 1: 0 2: 3 3: 42 4: 452 |
||||
| 1035752221_1035752229 | 14 | Left | 1035752221 | 8:2003718-2003740 | CCTAGAGCAGCTCCGTCTCACTG | 0: 1 1: 0 2: 2 3: 11 4: 180 |
||
| Right | 1035752229 | 8:2003755-2003777 | CTTTCATATTTTCAGTTGAAAGG | 0: 1 1: 0 2: 3 3: 42 4: 452 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035752229 | Original CRISPR | CTTTCATATTTTCAGTTGAA AGG | Exonic | ||