ID: 1035754507

View in Genome Browser
Species Human (GRCh38)
Location 8:2021776-2021798
Sequence CCGGCTGCACAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035754507_1035754514 17 Left 1035754507 8:2021776-2021798 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754514 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
1035754507_1035754516 18 Left 1035754507 8:2021776-2021798 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754516 8:2021817-2021839 CCAGCTCCAGCTGTGCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035754507 Original CRISPR CCGGCTGCACAGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr