ID: 1035754513

View in Genome Browser
Species Human (GRCh38)
Location 8:2021816-2021838
Sequence CCGGCTGCACAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035754513_1035754520 20 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754520 8:2021859-2021881 GTCGTGGCTCATCCCACTGTCGG No data
1035754513_1035754524 29 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754524 8:2021868-2021890 CATCCCACTGTCGGGGCGGCCGG No data
1035754513_1035754521 21 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754521 8:2021860-2021882 TCGTGGCTCATCCCACTGTCGGG No data
1035754513_1035754519 4 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754519 8:2021843-2021865 AGATGAATGAGATGCAGTCGTGG No data
1035754513_1035754525 30 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754525 8:2021869-2021891 ATCCCACTGTCGGGGCGGCCGGG No data
1035754513_1035754522 22 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754522 8:2021861-2021883 CGTGGCTCATCCCACTGTCGGGG No data
1035754513_1035754523 25 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754523 8:2021864-2021886 GGCTCATCCCACTGTCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035754513 Original CRISPR CCGGCTGCACAGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr