ID: 1035754524

View in Genome Browser
Species Human (GRCh38)
Location 8:2021868-2021890
Sequence CATCCCACTGTCGGGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035754515_1035754524 28 Left 1035754515 8:2021817-2021839 CCAGCTCCAGCTGTGCAGCCGGG No data
Right 1035754524 8:2021868-2021890 CATCCCACTGTCGGGGCGGCCGG No data
1035754518_1035754524 10 Left 1035754518 8:2021835-2021857 CCGGGCAGAGATGAATGAGATGC No data
Right 1035754524 8:2021868-2021890 CATCCCACTGTCGGGGCGGCCGG No data
1035754513_1035754524 29 Left 1035754513 8:2021816-2021838 CCCAGCTCCAGCTGTGCAGCCGG No data
Right 1035754524 8:2021868-2021890 CATCCCACTGTCGGGGCGGCCGG No data
1035754517_1035754524 22 Left 1035754517 8:2021823-2021845 CCAGCTGTGCAGCCGGGCAGAGA No data
Right 1035754524 8:2021868-2021890 CATCCCACTGTCGGGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035754524 Original CRISPR CATCCCACTGTCGGGGCGGC CGG Intergenic
No off target data available for this crispr