ID: 1035755364

View in Genome Browser
Species Human (GRCh38)
Location 8:2027051-2027073
Sequence GGATAGAGCCCTTGTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035755364_1035755371 14 Left 1035755364 8:2027051-2027073 CCTACCACACAAGGGCTCTATCC No data
Right 1035755371 8:2027088-2027110 AGCCTAAATTACCCCTTTGTAGG No data
1035755364_1035755372 15 Left 1035755364 8:2027051-2027073 CCTACCACACAAGGGCTCTATCC No data
Right 1035755372 8:2027089-2027111 GCCTAAATTACCCCTTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035755364 Original CRISPR GGATAGAGCCCTTGTGTGGT AGG (reversed) Intergenic
No off target data available for this crispr