ID: 1035758498

View in Genome Browser
Species Human (GRCh38)
Location 8:2051754-2051776
Sequence TACCCCGCACATGCCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035758498_1035758504 -4 Left 1035758498 8:2051754-2051776 CCAGGGCGGGCATGTGCGGGGTA No data
Right 1035758504 8:2051773-2051795 GGTATGGGTGTGGGCACACAGGG No data
1035758498_1035758505 3 Left 1035758498 8:2051754-2051776 CCAGGGCGGGCATGTGCGGGGTA No data
Right 1035758505 8:2051780-2051802 GTGTGGGCACACAGGGACACAGG No data
1035758498_1035758503 -5 Left 1035758498 8:2051754-2051776 CCAGGGCGGGCATGTGCGGGGTA No data
Right 1035758503 8:2051772-2051794 GGGTATGGGTGTGGGCACACAGG No data
1035758498_1035758507 9 Left 1035758498 8:2051754-2051776 CCAGGGCGGGCATGTGCGGGGTA No data
Right 1035758507 8:2051786-2051808 GCACACAGGGACACAGGCTTGGG No data
1035758498_1035758506 8 Left 1035758498 8:2051754-2051776 CCAGGGCGGGCATGTGCGGGGTA No data
Right 1035758506 8:2051785-2051807 GGCACACAGGGACACAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035758498 Original CRISPR TACCCCGCACATGCCCGCCC TGG (reversed) Intronic