ID: 1035759794

View in Genome Browser
Species Human (GRCh38)
Location 8:2061168-2061190
Sequence GTCTCCGGTTTAGTGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035759780_1035759794 22 Left 1035759780 8:2061123-2061145 CCCACCAAGCCTGGGGCCTGGTT 0: 1
1: 1
2: 5
3: 15
4: 224
Right 1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG No data
1035759784_1035759794 18 Left 1035759784 8:2061127-2061149 CCAAGCCTGGGGCCTGGTTGGGA 0: 1
1: 0
2: 6
3: 48
4: 328
Right 1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG No data
1035759785_1035759794 13 Left 1035759785 8:2061132-2061154 CCTGGGGCCTGGTTGGGAAGAGG 0: 1
1: 0
2: 9
3: 38
4: 392
Right 1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG No data
1035759788_1035759794 6 Left 1035759788 8:2061139-2061161 CCTGGTTGGGAAGAGGGTTGAAA 0: 1
1: 0
2: 2
3: 19
4: 198
Right 1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG No data
1035759781_1035759794 21 Left 1035759781 8:2061124-2061146 CCACCAAGCCTGGGGCCTGGTTG 0: 1
1: 0
2: 2
3: 32
4: 306
Right 1035759794 8:2061168-2061190 GTCTCCGGTTTAGTGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035759794 Original CRISPR GTCTCCGGTTTAGTGAGGGA GGG Intronic
No off target data available for this crispr