ID: 1035761081

View in Genome Browser
Species Human (GRCh38)
Location 8:2069343-2069365
Sequence TCTCACCACCACCGCCGCGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035761081_1035761088 5 Left 1035761081 8:2069343-2069365 CCAACGCGGCGGTGGTGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1035761088 8:2069371-2069393 GTGCCGGGTGGGCTTTCACGGGG 0: 1
1: 0
2: 0
3: 1
4: 57
1035761081_1035761084 -7 Left 1035761081 8:2069343-2069365 CCAACGCGGCGGTGGTGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1035761084 8:2069359-2069381 GGTGAGAAGTGAGTGCCGGGTGG 0: 1
1: 0
2: 1
3: 23
4: 234
1035761081_1035761087 4 Left 1035761081 8:2069343-2069365 CCAACGCGGCGGTGGTGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1035761087 8:2069370-2069392 AGTGCCGGGTGGGCTTTCACGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1035761081_1035761086 3 Left 1035761081 8:2069343-2069365 CCAACGCGGCGGTGGTGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1035761086 8:2069369-2069391 GAGTGCCGGGTGGGCTTTCACGG 0: 1
1: 0
2: 0
3: 9
4: 116
1035761081_1035761085 -6 Left 1035761081 8:2069343-2069365 CCAACGCGGCGGTGGTGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1035761085 8:2069360-2069382 GTGAGAAGTGAGTGCCGGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 168
1035761081_1035761083 -10 Left 1035761081 8:2069343-2069365 CCAACGCGGCGGTGGTGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1035761083 8:2069356-2069378 GGTGGTGAGAAGTGAGTGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035761081 Original CRISPR TCTCACCACCACCGCCGCGT TGG (reversed) Exonic
901193066 1:7424096-7424118 TCTCACCACCGTCCCCACGTGGG + Intronic
902817395 1:18924117-18924139 TTTCTCCACCACCGCCGGGAGGG - Intronic
905268563 1:36771651-36771673 TCTCCCCACGACCGCCGCCCTGG - Intergenic
909631592 1:77774383-77774405 CTTCACCACCACCGCCCAGTGGG - Intergenic
912755887 1:112324709-112324731 TCTCACCACCACCTGCACTTGGG + Intergenic
922723916 1:227913919-227913941 TCTCTCCATCACCCCCGCCTTGG + Intergenic
922854787 1:228765681-228765703 TCTCACCACCCCCACCCCATGGG + Intergenic
1076633626 10:131868497-131868519 TACGACCACCACCTCCGCGTTGG - Intergenic
1077922837 11:6654858-6654880 TCTCCCCACCCCCTCCACGTGGG + Intronic
1081591463 11:44426188-44426210 TGTCACCACCAACACCGCATGGG + Intergenic
1085304058 11:75475289-75475311 TCTCACCACCCCCGCCCCAGGGG - Intronic
1085720063 11:78904626-78904648 TCTCACAACCACTGCAGAGTAGG + Intronic
1088686003 11:112284989-112285011 TTTCACCACCACTGCCGCTCTGG - Intergenic
1089403078 11:118176065-118176087 TCTCTGCCCCACCGCCACGTAGG + Intronic
1093749832 12:22785423-22785445 TGTCACCACCACCCCCAAGTAGG - Intergenic
1099478600 12:83139981-83140003 TCTCACCACCTCCTCGGCCTCGG + Intergenic
1103611578 12:122127378-122127400 TCTGACCACCACCGGCGCCCAGG - Intronic
1104858834 12:131914338-131914360 TCTCTCCACCACAGCCGGGCTGG + Exonic
1106127673 13:26913619-26913641 TCTCAACACCATCACCTCGTGGG - Intergenic
1108668187 13:52653087-52653109 TCTCACCTCTAACGCCGCCTGGG - Exonic
1111748248 13:92296527-92296549 TCTCAGCACCACCCCTGCCTGGG + Intronic
1119574939 14:75711636-75711658 TCTTCCCACCTCCGCCGCATGGG - Intronic
1122211658 14:100177895-100177917 TCTCCCCACCCCCGCCGCCGCGG - Intergenic
1122402489 14:101475592-101475614 TCTCACCACCACCCCAACCTGGG + Intergenic
1124801836 15:32840235-32840257 TCTCACCACCACAGCCCCTTTGG - Intronic
1127988832 15:64096156-64096178 ACTCACGACCACCGCGGCGCCGG - Exonic
1132588191 16:715235-715257 TCTCACCACCGCTGCCCCGGCGG - Exonic
1135479825 16:22813710-22813732 TCTCCTCCCCACCCCCGCGTGGG + Intergenic
1137945633 16:52731280-52731302 TCTCAGCACCACCTCAGCCTCGG + Intergenic
1139911969 16:70403132-70403154 TCTCACCACCTCCACCACCTGGG - Intronic
1148323835 17:46772067-46772089 TCCCCACACCACCGCCGCGTGGG - Intronic
1152293165 17:79452305-79452327 TGTCACCACCTCCGCTGCGGAGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1161007811 19:1945138-1945160 TCTGGCCACCACCGCTGCTTGGG + Intronic
1161092927 19:2371810-2371832 TCACCCCATCACCACCGCGTTGG + Intergenic
1162122062 19:8476884-8476906 TCCCACCACCACCGACTCCTGGG + Intronic
1163638382 19:18448441-18448463 TATCACCACCACCCCCACCTGGG + Intronic
1165770167 19:38375314-38375336 TTCCCCCACCACCCCCGCGTGGG - Intronic
928220792 2:29401268-29401290 TCTCACCACCACCTCCACCAAGG - Intronic
930492221 2:52089716-52089738 TCTTACCACCACCACCACGAGGG - Intergenic
934728218 2:96638593-96638615 TCTCGCCACCCCCACCGTGTTGG + Intronic
938405677 2:131031928-131031950 CCCCACCACCACCACCGTGTGGG + Intronic
1168892771 20:1305651-1305673 TGTCACCACCACTGCTGAGTTGG - Exonic
1171768073 20:29300974-29300996 TCTCACCACCACAGACACGAGGG + Intergenic
1173395760 20:42678016-42678038 TCGCACCACCACAGGCACGTGGG - Exonic
1180911924 22:19456690-19456712 TCTCACCCCCACCCCCGGCTAGG + Intronic
1181583170 22:23838894-23838916 TGTCCTCACCACCGCCGCGGTGG - Exonic
1203252499 22_KI270733v1_random:124763-124785 TCCCCCCACCACCGCCGCCGCGG - Intergenic
954123831 3:48517141-48517163 GCTCACCACGACCTCCGCCTCGG - Intergenic
957077209 3:75611610-75611632 TCACATCACCACCTCCGCCTTGG - Intergenic
968512582 4:1002139-1002161 CTTCACCACCATGGCCGCGTAGG - Exonic
969077349 4:4590509-4590531 TCTCTCCACCACCCCCAGGTGGG + Intergenic
977536322 4:98260435-98260457 TCCCACCACCACCTCGGCCTCGG - Intergenic
1004862977 6:19824583-19824605 TGTAACCACCACAGCCGCTTTGG - Intergenic
1005750006 6:28873090-28873112 TCTCAGCACCTCCGCTGCCTGGG - Intergenic
1006891563 6:37433438-37433460 TCTCCCCTCCACCGCCGCCTGGG + Intronic
1026731191 7:72913272-72913294 TCTCCCCACCTCCACTGCGTCGG + Intronic
1027112890 7:75454797-75454819 TCTCCCCACCTCCACTGCGTCGG - Intronic
1027285136 7:76639408-76639430 TCTCCCCACCTCCACTGCGTCGG - Intergenic
1029482195 7:100819923-100819945 TCTCCCCACCACCGCAGAGCAGG - Intronic
1035761081 8:2069343-2069365 TCTCACCACCACCGCCGCGTTGG - Exonic
1037313698 8:17581512-17581534 TCCCACCACCACCACCACATGGG - Intronic
1037346697 8:17908691-17908713 TGTCACCACCACCGCGGCTGTGG - Intronic
1055394047 9:75854524-75854546 TCTCATCACAACCTCCTCGTTGG + Intergenic
1060154625 9:121310721-121310743 TCTCTGCACCACCACCTCGTTGG - Exonic
1062640268 9:137515128-137515150 TCTCACCCCCACCACCGCCAGGG - Intronic
1195438191 X:104869868-104869890 TTTCACCACCACCACCACGCTGG + Intronic