ID: 1035761091

View in Genome Browser
Species Human (GRCh38)
Location 8:2069399-2069421
Sequence CAGAAAAGAGAAAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2357
Summary {0: 1, 1: 3, 2: 16, 3: 246, 4: 2091}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035761091_1035761096 4 Left 1035761091 8:2069399-2069421 CCCGCCTCCTTTTCTCTTTTCTG 0: 1
1: 3
2: 16
3: 246
4: 2091
Right 1035761096 8:2069426-2069448 ACTCACTTTGCTGTCTTGCAGGG 0: 1
1: 0
2: 3
3: 21
4: 177
1035761091_1035761099 12 Left 1035761091 8:2069399-2069421 CCCGCCTCCTTTTCTCTTTTCTG 0: 1
1: 3
2: 16
3: 246
4: 2091
Right 1035761099 8:2069434-2069456 TGCTGTCTTGCAGGGTTCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 148
1035761091_1035761100 20 Left 1035761091 8:2069399-2069421 CCCGCCTCCTTTTCTCTTTTCTG 0: 1
1: 3
2: 16
3: 246
4: 2091
Right 1035761100 8:2069442-2069464 TGCAGGGTTCCGGGGAGACGAGG 0: 1
1: 0
2: 1
3: 11
4: 158
1035761091_1035761098 11 Left 1035761091 8:2069399-2069421 CCCGCCTCCTTTTCTCTTTTCTG 0: 1
1: 3
2: 16
3: 246
4: 2091
Right 1035761098 8:2069433-2069455 TTGCTGTCTTGCAGGGTTCCGGG 0: 1
1: 0
2: 1
3: 15
4: 189
1035761091_1035761095 3 Left 1035761091 8:2069399-2069421 CCCGCCTCCTTTTCTCTTTTCTG 0: 1
1: 3
2: 16
3: 246
4: 2091
Right 1035761095 8:2069425-2069447 CACTCACTTTGCTGTCTTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 168
1035761091_1035761097 10 Left 1035761091 8:2069399-2069421 CCCGCCTCCTTTTCTCTTTTCTG 0: 1
1: 3
2: 16
3: 246
4: 2091
Right 1035761097 8:2069432-2069454 TTTGCTGTCTTGCAGGGTTCCGG 0: 1
1: 0
2: 1
3: 25
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035761091 Original CRISPR CAGAAAAGAGAAAAGGAGGC GGG (reversed) Intronic
Too many off-targets to display for this crispr