ID: 1035762794

View in Genome Browser
Species Human (GRCh38)
Location 8:2081628-2081650
Sequence ATTGAGAAGAGCACTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035762789_1035762794 -8 Left 1035762789 8:2081613-2081635 CCTTCTGTAAAGGCCATTGAGAA 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035762794 Original CRISPR ATTGAGAAGAGCACTGGGGA AGG Intronic
No off target data available for this crispr