ID: 1035764402

View in Genome Browser
Species Human (GRCh38)
Location 8:2094227-2094249
Sequence TTTCTTTGAAGCCTCTCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035764400_1035764402 -4 Left 1035764400 8:2094208-2094230 CCTGAACAGAGAACTTGAGTTTC 0: 1
1: 0
2: 1
3: 23
4: 207
Right 1035764402 8:2094227-2094249 TTTCTTTGAAGCCTCTCGGTTGG 0: 1
1: 1
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035764402 Original CRISPR TTTCTTTGAAGCCTCTCGGT TGG Intronic
901260971 1:7870416-7870438 TGTCATTGAAGCCTCTCAGTCGG + Intergenic
905472755 1:38205958-38205980 TTTCTAGGAAGCCTGTCGGGTGG - Intergenic
909671645 1:78195863-78195885 GTTCTTTTAAGCCACTCAGTTGG - Intergenic
909711786 1:78659606-78659628 TTTCATTGAAGCATCCTGGTAGG - Intronic
910613800 1:89174615-89174637 TTTCTTGCAAGCCCCTCTGTGGG + Intronic
913400273 1:118423894-118423916 TTTCCTTAAAGCCATTCGGTTGG + Intergenic
916039856 1:160952647-160952669 TTTCTTTGCAGCTTCTAGGCAGG + Exonic
918625171 1:186649091-186649113 TTTCTTTAAAGACTCTGAGTTGG + Intergenic
919535682 1:198784746-198784768 TTTCTTTGTAGTCTCTTTGTTGG - Intergenic
921257128 1:213352602-213352624 GCTCTTTGAAGCTTCTCAGTTGG + Intergenic
924049729 1:240068560-240068582 TTTCTTTGAATCCTGTGTGTTGG + Intronic
1064850680 10:19705821-19705843 TTCCTTTGAAGCCTCTCTTGTGG - Intronic
1065284495 10:24174541-24174563 TCCCTCTGAAGCCTCTAGGTGGG - Intronic
1065865434 10:29911035-29911057 AGTCTTTGAAGCCTTTGGGTAGG - Intergenic
1071816471 10:89237366-89237388 TTTATATGCAGCCTCTTGGTTGG - Intronic
1079750167 11:24186770-24186792 TGTCTTTGAAACCTCTGGGCTGG - Intergenic
1084713910 11:70861665-70861687 TTTCTTTGACTCCTCTGGGCAGG + Intronic
1086633192 11:89049089-89049111 TTACTTTGAAGACTCTCTGGAGG - Intronic
1087815607 11:102655046-102655068 TTTCTTTGAAACCTCCCCATGGG + Intergenic
1089727992 11:120499874-120499896 TTTCTTTAAAGAATCTCAGTGGG + Intergenic
1090384888 11:126351988-126352010 TTTCCTTGAAACCTCTTGGTTGG - Intergenic
1095366249 12:41409792-41409814 GTTCTCTGAAGCCTCTAGGGAGG + Intronic
1100822507 12:98444595-98444617 GTTCTTTGGAGACTCTCTGTTGG - Intergenic
1101633752 12:106520308-106520330 TTTCTTTGAAGCCTCTCTTGTGG - Intronic
1103206884 12:119136771-119136793 TTTCTTTGAAGCCTCTCCTGAGG - Intronic
1110068350 13:71139381-71139403 TTTATTTGAAGCATCTCTTTTGG - Intergenic
1110544731 13:76743847-76743869 TTTCTCTGAAGGCTTTCGATGGG + Intergenic
1116213398 14:41977172-41977194 TTTCTTGGAAACCTTTCGTTTGG - Intergenic
1117791640 14:59348310-59348332 TTTCTTTGTAGCCTCTCCAACGG + Intronic
1122460652 14:101891889-101891911 TTGCTTTGGAGGCTCTAGGTAGG + Intronic
1135476354 16:22779463-22779485 ATTCTTTGATGCCTATTGGTAGG + Intergenic
1141394857 16:83695568-83695590 TTTCTTTGGAGCCTAGCTGTGGG - Intronic
1146318273 17:31826232-31826254 TTTTTTTGAGGCCTTTTGGTTGG - Intergenic
1148656338 17:49286553-49286575 TTTGTTTGAAGTCACTCAGTTGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1151467451 17:74296524-74296546 TTCCTTTTAAGCTTTTCGGTAGG + Intronic
1151859370 17:76748341-76748363 TTTCTGTGAGGCCTTTAGGTGGG - Intronic
1152003581 17:77662749-77662771 GTTCTTTGAAGCCACTCACTTGG + Intergenic
1155179992 18:23336370-23336392 TTCCTTTGCAGACTCTCGCTCGG - Intronic
1156706754 18:39891818-39891840 TTTCTATGAAGACTCTAGGAAGG + Intergenic
1156928218 18:42609392-42609414 TTTCTCTGGAGGCTCTCGGATGG + Intergenic
1160614971 18:80119288-80119310 TTTATTGGAAGCCTCTTGGGGGG + Intronic
1161374300 19:3931276-3931298 TTTCCTGGCAGCCTCTTGGTGGG - Intergenic
926276604 2:11408077-11408099 TTCCTCTAAAGCCTCTAGGTAGG + Intergenic
927037749 2:19197918-19197940 TTTCTTTTTAGCCTGTCGATGGG - Intergenic
927929205 2:27033286-27033308 TCTCTTTGGAGCCTCACGGGAGG + Intronic
929049679 2:37825494-37825516 TTTCTTTGAAGCCCCTCTAGAGG - Intergenic
929353753 2:40993967-40993989 TTTCTTAAAAGCCTCTAGGATGG - Intergenic
929943674 2:46354042-46354064 CTTCACTGAAGCCTCTTGGTAGG + Intronic
933304086 2:80576118-80576140 TTTCTTTGCAGCCTTTGGGAGGG - Intronic
935945931 2:108286763-108286785 TTTCCTTGAAGCCTTTCCTTAGG - Intergenic
940277194 2:151951660-151951682 TTTCCTTGAAGCCTGTGGGCCGG - Intronic
941907223 2:170728552-170728574 GTTGTTTGAAGCCTCTAAGTTGG - Intergenic
942259048 2:174139336-174139358 TCTCTCTGAAGCCTCTCTGGGGG - Intronic
944112052 2:196143189-196143211 TGTCTTTGAAGCCTGGCTGTTGG - Intronic
948731511 2:239966728-239966750 TTTCTTTGTAGCCTTCCGGTTGG - Intronic
1175419168 20:58820523-58820545 TTTCTCTGAGGCCTCTGGCTTGG - Intergenic
1177510480 21:22080495-22080517 TTTCTTTTCTGCCTCTCTGTAGG - Intergenic
1178439799 21:32589352-32589374 TTTCTTTTAAGTCTTTCTGTAGG + Intronic
1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG + Intronic
1182370021 22:29804239-29804261 CTTCTTGGAAGCCCCTCCGTGGG - Intronic
1183038005 22:35154813-35154835 CTTCTTTGAATCTTCTCTGTTGG + Intergenic
1183258102 22:36776026-36776048 CTTCCTTGAACCCTCTGGGTAGG - Exonic
950572736 3:13811959-13811981 TGTCTCTGAAGCCTCTCGCGGGG + Intergenic
954661294 3:52228303-52228325 TTTCTTCGAAGCCACTAAGTTGG + Intergenic
959896790 3:111615230-111615252 TTTCTGTGGATCCTCTCAGTGGG - Intronic
964533784 3:157697136-157697158 TTTCCTTGAAGACTCTGGGAAGG + Intergenic
966038774 3:175454406-175454428 TTTCTTTGCAGTCTCTTGGGAGG + Intronic
976758460 4:88523454-88523476 TTCCTTTGCAGCCTCCCGGTGGG - Intronic
979936308 4:126701177-126701199 TTTCATGGAAGCCTGTTGGTTGG - Intergenic
986916812 5:12629510-12629532 TTTCTTTGACACATCTAGGTTGG + Intergenic
989850548 5:46203876-46203898 TTTCTTTGCAGTTTCTGGGTAGG + Intergenic
992656561 5:78916186-78916208 TTTCTTTTAAGGCTCTCAGCAGG + Intronic
992658112 5:78930462-78930484 TTTCTTTGAATAGTCACGGTAGG + Intronic
994595197 5:101823683-101823705 TATCTCTGAAGCCTGTTGGTTGG + Intergenic
994785210 5:104151148-104151170 TTTGCTTGAATCCTCTCAGTTGG + Intergenic
996614789 5:125428414-125428436 TTTGTCTGCAGCCTCTTGGTTGG - Intergenic
998049012 5:139015719-139015741 TTGCTTGGAAGCCTCTGGGAAGG - Intronic
1001639785 5:173236196-173236218 TTTCTCTGAGGCCTCTGGGCCGG + Intergenic
1004299754 6:14446533-14446555 GTTTTTTGAAGCCTCTCAGTTGG - Intergenic
1007241134 6:40425978-40426000 TTTCTGTGAAACCTCGAGGTGGG + Intronic
1009514760 6:64601120-64601142 TCTCTTTGTAGCCTCTAGTTTGG + Intronic
1009702070 6:67197009-67197031 TTTATTTGAAGCCTGTTAGTTGG - Intergenic
1011237597 6:85234421-85234443 TTTTTTTAAAGCCTCACTGTAGG - Intergenic
1015103766 6:129511957-129511979 TATCTTAGAAGTCTCTCTGTTGG - Intronic
1015142848 6:129955300-129955322 TTTCTTTGCTGCCTTTCTGTTGG + Intergenic
1018280242 6:162178115-162178137 TTTCTGTGAAGCCACTAGGTAGG + Intronic
1023729402 7:43176448-43176470 TTTATTTGAATCCTGTAGGTTGG + Intronic
1024623941 7:51188319-51188341 TTACTTTCAATCCTCTTGGTAGG - Intronic
1027007974 7:74712353-74712375 TTTCATTGAAGCCTTTCTTTGGG + Intronic
1034212505 7:149376403-149376425 TTGCTTGTAAGCCTCTGGGTGGG + Intergenic
1035764402 8:2094227-2094249 TTTCTTTGAAGCCTCTCGGTTGG + Intronic
1036467270 8:9012120-9012142 TTTTTTTGAAGCTTTTCAGTTGG + Intronic
1038446432 8:27607466-27607488 TCTCTTTTAAGCATCTGGGTTGG - Intronic
1040097795 8:43464145-43464167 TTTCACTGGAGCCTCTTGGTTGG + Intergenic
1041388471 8:57328697-57328719 TTTCTTGGAAGTCTCTGTGTAGG - Intergenic
1045769906 8:105723935-105723957 CTTGTTTGTAGCCTCTTGGTTGG + Intronic
1050845925 9:10218335-10218357 TTTCTTTCAAACCTCTTGGGTGG - Intronic
1055357452 9:75451932-75451954 TTTCTTAAAATCCTCTCAGTAGG - Intergenic
1058314168 9:103543672-103543694 TTTCTTTTAAGCTTTTTGGTTGG + Intergenic
1186180369 X:6967694-6967716 TTTCTCTGAGGCCTCTGGGAAGG - Intergenic
1187302186 X:18061391-18061413 TTTTTTTCAAGCCCCTCAGTAGG + Intergenic
1187716360 X:22106411-22106433 TTTCTGTGAAGCATCTTTGTTGG + Intronic
1188342608 X:29022836-29022858 TTTCTATGAAGCCTATAGATTGG - Intronic
1192441524 X:71178175-71178197 ACTCTTTGAAGCCTCTCTTTTGG - Intergenic
1195285937 X:103384022-103384044 TTTCTTTGTAGGCTCTTGATTGG + Intergenic