ID: 1035767446

View in Genome Browser
Species Human (GRCh38)
Location 8:2118724-2118746
Sequence CCCCTGCAGGACCCAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035767441_1035767446 4 Left 1035767441 8:2118697-2118719 CCAAGGCTGGTGGGCAAGTGGGG 0: 1
1: 0
2: 16
3: 153
4: 875
Right 1035767446 8:2118724-2118746 CCCCTGCAGGACCCAGAGGCTGG No data
1035767439_1035767446 5 Left 1035767439 8:2118696-2118718 CCCAAGGCTGGTGGGCAAGTGGG 0: 1
1: 0
2: 4
3: 22
4: 331
Right 1035767446 8:2118724-2118746 CCCCTGCAGGACCCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035767446 Original CRISPR CCCCTGCAGGACCCAGAGGC TGG Intronic
No off target data available for this crispr