ID: 1035767649

View in Genome Browser
Species Human (GRCh38)
Location 8:2119847-2119869
Sequence CCTTCACAGGGAGCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035767649_1035767667 25 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767667 8:2119895-2119917 AAAAACCAGGGCAGAGCAAGCGG No data
1035767649_1035767660 -6 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767660 8:2119864-2119886 TGAAGGACAATGAGGGGGCGGGG No data
1035767649_1035767659 -7 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767659 8:2119863-2119885 GTGAAGGACAATGAGGGGGCGGG No data
1035767649_1035767663 -3 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767663 8:2119867-2119889 AGGACAATGAGGGGGCGGGGGGG No data
1035767649_1035767665 13 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767665 8:2119883-2119905 GGGGGGGATGCCAAAAACCAGGG No data
1035767649_1035767661 -5 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767661 8:2119865-2119887 GAAGGACAATGAGGGGGCGGGGG No data
1035767649_1035767658 -8 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767658 8:2119862-2119884 TGTGAAGGACAATGAGGGGGCGG No data
1035767649_1035767664 12 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767664 8:2119882-2119904 CGGGGGGGATGCCAAAAACCAGG No data
1035767649_1035767662 -4 Left 1035767649 8:2119847-2119869 CCCAGGGCAGCTCCCTGTGAAGG No data
Right 1035767662 8:2119866-2119888 AAGGACAATGAGGGGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035767649 Original CRISPR CCTTCACAGGGAGCTGCCCT GGG (reversed) Intronic