ID: 1035775928

View in Genome Browser
Species Human (GRCh38)
Location 8:2188239-2188261
Sequence TCATAGCTTGAGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035775928_1035775931 -9 Left 1035775928 8:2188239-2188261 CCCTCCACTTTCTCAAGCTATGA No data
Right 1035775931 8:2188253-2188275 AAGCTATGAGTCACAAGCAATGG No data
1035775928_1035775934 22 Left 1035775928 8:2188239-2188261 CCCTCCACTTTCTCAAGCTATGA No data
Right 1035775934 8:2188284-2188306 GTGTAGCTCCATTTCTAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035775928 Original CRISPR TCATAGCTTGAGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr