ID: 1035777012

View in Genome Browser
Species Human (GRCh38)
Location 8:2196068-2196090
Sequence TGGCGGGGCTGCCCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035777012_1035777016 -7 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777016 8:2196084-2196106 CCCGCCAGCCTCTGCATGGCCGG No data
1035777012_1035777020 -4 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777020 8:2196087-2196109 GCCAGCCTCTGCATGGCCGGGGG No data
1035777012_1035777018 -6 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777018 8:2196085-2196107 CCGCCAGCCTCTGCATGGCCGGG No data
1035777012_1035777024 12 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data
1035777012_1035777026 17 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777026 8:2196108-2196130 GGAGTTACACCCTTGAGGACGGG No data
1035777012_1035777025 16 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777025 8:2196107-2196129 GGGAGTTACACCCTTGAGGACGG No data
1035777012_1035777019 -5 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777019 8:2196086-2196108 CGCCAGCCTCTGCATGGCCGGGG No data
1035777012_1035777027 24 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777027 8:2196115-2196137 CACCCTTGAGGACGGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035777012 Original CRISPR TGGCGGGGCTGCCCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr