ID: 1035777017

View in Genome Browser
Species Human (GRCh38)
Location 8:2196085-2196107
Sequence CCCGGCCATGCAGAGGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035777017_1035777025 -1 Left 1035777017 8:2196085-2196107 CCGCCAGCCTCTGCATGGCCGGG No data
Right 1035777025 8:2196107-2196129 GGGAGTTACACCCTTGAGGACGG No data
1035777017_1035777027 7 Left 1035777017 8:2196085-2196107 CCGCCAGCCTCTGCATGGCCGGG No data
Right 1035777027 8:2196115-2196137 CACCCTTGAGGACGGGTTCCAGG No data
1035777017_1035777026 0 Left 1035777017 8:2196085-2196107 CCGCCAGCCTCTGCATGGCCGGG No data
Right 1035777026 8:2196108-2196130 GGAGTTACACCCTTGAGGACGGG No data
1035777017_1035777024 -5 Left 1035777017 8:2196085-2196107 CCGCCAGCCTCTGCATGGCCGGG No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035777017 Original CRISPR CCCGGCCATGCAGAGGCTGG CGG (reversed) Intergenic
No off target data available for this crispr