ID: 1035777022

View in Genome Browser
Species Human (GRCh38)
Location 8:2196092-2196114
Sequence TAACTCCCCCGGCCATGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035777022_1035777026 -7 Left 1035777022 8:2196092-2196114 CCTCTGCATGGCCGGGGGAGTTA No data
Right 1035777026 8:2196108-2196130 GGAGTTACACCCTTGAGGACGGG No data
1035777022_1035777025 -8 Left 1035777022 8:2196092-2196114 CCTCTGCATGGCCGGGGGAGTTA No data
Right 1035777025 8:2196107-2196129 GGGAGTTACACCCTTGAGGACGG No data
1035777022_1035777027 0 Left 1035777022 8:2196092-2196114 CCTCTGCATGGCCGGGGGAGTTA No data
Right 1035777027 8:2196115-2196137 CACCCTTGAGGACGGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035777022 Original CRISPR TAACTCCCCCGGCCATGCAG AGG (reversed) Intergenic
No off target data available for this crispr