ID: 1035777024

View in Genome Browser
Species Human (GRCh38)
Location 8:2196103-2196125
Sequence CCGGGGGAGTTACACCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035777014_1035777024 -3 Left 1035777014 8:2196083-2196105 CCCCGCCAGCCTCTGCATGGCCG No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data
1035777017_1035777024 -5 Left 1035777017 8:2196085-2196107 CCGCCAGCCTCTGCATGGCCGGG No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data
1035777021_1035777024 -8 Left 1035777021 8:2196088-2196110 CCAGCCTCTGCATGGCCGGGGGA No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data
1035777012_1035777024 12 Left 1035777012 8:2196068-2196090 CCTGACACAGGGCAGCCCCGCCA No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data
1035777011_1035777024 13 Left 1035777011 8:2196067-2196089 CCCTGACACAGGGCAGCCCCGCC No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data
1035777015_1035777024 -4 Left 1035777015 8:2196084-2196106 CCCGCCAGCCTCTGCATGGCCGG No data
Right 1035777024 8:2196103-2196125 CCGGGGGAGTTACACCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035777024 Original CRISPR CCGGGGGAGTTACACCCTTG AGG Intergenic
No off target data available for this crispr