ID: 1035777713

View in Genome Browser
Species Human (GRCh38)
Location 8:2202336-2202358
Sequence TCAAAGGAGTGCAGAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035777711_1035777713 3 Left 1035777711 8:2202310-2202332 CCTCTGTTGGTTCTGAAATAAAC No data
Right 1035777713 8:2202336-2202358 TCAAAGGAGTGCAGAGCCAGTGG No data
1035777709_1035777713 5 Left 1035777709 8:2202308-2202330 CCCCTCTGTTGGTTCTGAAATAA No data
Right 1035777713 8:2202336-2202358 TCAAAGGAGTGCAGAGCCAGTGG No data
1035777710_1035777713 4 Left 1035777710 8:2202309-2202331 CCCTCTGTTGGTTCTGAAATAAA No data
Right 1035777713 8:2202336-2202358 TCAAAGGAGTGCAGAGCCAGTGG No data
1035777708_1035777713 9 Left 1035777708 8:2202304-2202326 CCATCCCCTCTGTTGGTTCTGAA No data
Right 1035777713 8:2202336-2202358 TCAAAGGAGTGCAGAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035777713 Original CRISPR TCAAAGGAGTGCAGAGCCAG TGG Intergenic
No off target data available for this crispr