ID: 1035779469

View in Genome Browser
Species Human (GRCh38)
Location 8:2216453-2216475
Sequence AGCAGAACTCGGATTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035779460_1035779469 6 Left 1035779460 8:2216424-2216446 CCTCCCACCCCGTGGTCCTACAT No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779457_1035779469 16 Left 1035779457 8:2216414-2216436 CCACTTTCACCCTCCCACCCCGT No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779459_1035779469 7 Left 1035779459 8:2216423-2216445 CCCTCCCACCCCGTGGTCCTACA No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779464_1035779469 -2 Left 1035779464 8:2216432-2216454 CCCGTGGTCCTACATGTCCTCAG No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779462_1035779469 2 Left 1035779462 8:2216428-2216450 CCACCCCGTGGTCCTACATGTCC No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779461_1035779469 3 Left 1035779461 8:2216427-2216449 CCCACCCCGTGGTCCTACATGTC No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779465_1035779469 -3 Left 1035779465 8:2216433-2216455 CCGTGGTCCTACATGTCCTCAGC No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779463_1035779469 -1 Left 1035779463 8:2216431-2216453 CCCCGTGGTCCTACATGTCCTCA No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779456_1035779469 25 Left 1035779456 8:2216405-2216427 CCTGCAGGGCCACTTTCACCCTC No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data
1035779466_1035779469 -10 Left 1035779466 8:2216440-2216462 CCTACATGTCCTCAGCAGAACTC No data
Right 1035779469 8:2216453-2216475 AGCAGAACTCGGATTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035779469 Original CRISPR AGCAGAACTCGGATTTTCAC AGG Intergenic
No off target data available for this crispr