ID: 1035783256

View in Genome Browser
Species Human (GRCh38)
Location 8:2244969-2244991
Sequence GGCTCAGGGCCAGCTCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035783256_1035783273 25 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783273 8:2245017-2245039 CACAGGGAGCAGGCGGCCTGTGG No data
1035783256_1035783266 9 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783266 8:2245001-2245023 CAGGGAGCCCCCGCTGCACAGGG No data
1035783256_1035783259 -9 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783259 8:2244983-2245005 CCCTGAGCCCCCGCTGCACAGGG No data
1035783256_1035783274 26 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783274 8:2245018-2245040 ACAGGGAGCAGGCGGCCTGTGGG No data
1035783256_1035783257 -10 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783257 8:2244982-2245004 GCCCTGAGCCCCCGCTGCACAGG No data
1035783256_1035783271 18 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783271 8:2245010-2245032 CCCGCTGCACAGGGAGCAGGCGG No data
1035783256_1035783267 15 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783267 8:2245007-2245029 GCCCCCGCTGCACAGGGAGCAGG No data
1035783256_1035783265 8 Left 1035783256 8:2244969-2244991 CCAGGTAGAGCTGGCCCTGAGCC No data
Right 1035783265 8:2245000-2245022 ACAGGGAGCCCCCGCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035783256 Original CRISPR GGCTCAGGGCCAGCTCTACC TGG (reversed) Intergenic
No off target data available for this crispr