ID: 1035787296

View in Genome Browser
Species Human (GRCh38)
Location 8:2271830-2271852
Sequence CCAAGTTTAGGAAAGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035787296_1035787301 6 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787301 8:2271859-2271881 TTTATATATTCTGTTATGGGCGG No data
1035787296_1035787300 3 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787300 8:2271856-2271878 TGTTTTATATATTCTGTTATGGG No data
1035787296_1035787306 27 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787306 8:2271880-2271902 GGGGCAGGGTGCTCTCTATTTGG No data
1035787296_1035787299 2 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787299 8:2271855-2271877 ATGTTTTATATATTCTGTTATGG No data
1035787296_1035787305 13 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG No data
1035787296_1035787302 7 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787302 8:2271860-2271882 TTATATATTCTGTTATGGGCGGG No data
1035787296_1035787304 12 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787304 8:2271865-2271887 TATTCTGTTATGGGCGGGGCAGG No data
1035787296_1035787303 8 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787303 8:2271861-2271883 TATATATTCTGTTATGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035787296 Original CRISPR CCAAGTTTAGGAAAGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr