ID: 1035787305

View in Genome Browser
Species Human (GRCh38)
Location 8:2271866-2271888
Sequence ATTCTGTTATGGGCGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035787298_1035787305 1 Left 1035787298 8:2271842-2271864 CCTAAACTTGGAGATGTTTTATA No data
Right 1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG No data
1035787296_1035787305 13 Left 1035787296 8:2271830-2271852 CCAGGCAGCTTTCCTAAACTTGG No data
Right 1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035787305 Original CRISPR ATTCTGTTATGGGCGGGGCA GGG Intergenic
No off target data available for this crispr