ID: 1035792217

View in Genome Browser
Species Human (GRCh38)
Location 8:2317373-2317395
Sequence GCCTCACGCCCTGTTCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035792217_1035792219 -10 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792219 8:2317386-2317408 GGCGTGAGGCTGCCGTCATGAGG No data
1035792217_1035792223 -4 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792223 8:2317392-2317414 AGGCTGCCGTCATGAGGGGGCGG No data
1035792217_1035792222 -7 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792222 8:2317389-2317411 GTGAGGCTGCCGTCATGAGGGGG No data
1035792217_1035792226 21 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792226 8:2317417-2317439 CCTCTGTGAGCCTCTGACGCTGG No data
1035792217_1035792221 -8 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792221 8:2317388-2317410 CGTGAGGCTGCCGTCATGAGGGG No data
1035792217_1035792227 26 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792227 8:2317422-2317444 GTGAGCCTCTGACGCTGGTGTGG No data
1035792217_1035792220 -9 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792220 8:2317387-2317409 GCGTGAGGCTGCCGTCATGAGGG No data
1035792217_1035792228 29 Left 1035792217 8:2317373-2317395 CCCGGAGGAACAGGGCGTGAGGC No data
Right 1035792228 8:2317425-2317447 AGCCTCTGACGCTGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035792217 Original CRISPR GCCTCACGCCCTGTTCCTCC GGG (reversed) Intergenic
No off target data available for this crispr