ID: 1035793032

View in Genome Browser
Species Human (GRCh38)
Location 8:2325463-2325485
Sequence CTGTGAAGTTACCATGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035793029_1035793032 10 Left 1035793029 8:2325430-2325452 CCTGTGGTTCCGTCACACAGTCG No data
Right 1035793032 8:2325463-2325485 CTGTGAAGTTACCATGTGAAAGG No data
1035793031_1035793032 1 Left 1035793031 8:2325439-2325461 CCGTCACACAGTCGTCTGGATGT No data
Right 1035793032 8:2325463-2325485 CTGTGAAGTTACCATGTGAAAGG No data
1035793027_1035793032 28 Left 1035793027 8:2325412-2325434 CCTGGCGAGGCGGTGGCGCCTGT No data
Right 1035793032 8:2325463-2325485 CTGTGAAGTTACCATGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035793032 Original CRISPR CTGTGAAGTTACCATGTGAA AGG Intergenic
No off target data available for this crispr