ID: 1035795230

View in Genome Browser
Species Human (GRCh38)
Location 8:2350034-2350056
Sequence TGGTGAAAGGGGAAGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035795230_1035795235 -3 Left 1035795230 8:2350034-2350056 CCTGTTTGCTTCCCCTTTCACCA No data
Right 1035795235 8:2350054-2350076 CCATGATTGTAAGTTTCCTGAGG 0: 5548
1: 8228
2: 6830
3: 4292
4: 3006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035795230 Original CRISPR TGGTGAAAGGGGAAGCAAAC AGG (reversed) Intergenic
No off target data available for this crispr