ID: 1035796320

View in Genome Browser
Species Human (GRCh38)
Location 8:2360488-2360510
Sequence AAAGATCTGAAGTTTAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035796320_1035796323 2 Left 1035796320 8:2360488-2360510 CCCAGCCTAAACTTCAGATCTTT No data
Right 1035796323 8:2360513-2360535 GAGAACAGAAATGCCAGTTCTGG No data
1035796320_1035796325 20 Left 1035796320 8:2360488-2360510 CCCAGCCTAAACTTCAGATCTTT No data
Right 1035796325 8:2360531-2360553 TCTGGTTAGAAAGACCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035796320 Original CRISPR AAAGATCTGAAGTTTAGGCT GGG (reversed) Intergenic