ID: 1035796321

View in Genome Browser
Species Human (GRCh38)
Location 8:2360489-2360511
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035796321_1035796325 19 Left 1035796321 8:2360489-2360511 CCAGCCTAAACTTCAGATCTTTA No data
Right 1035796325 8:2360531-2360553 TCTGGTTAGAAAGACCTGCATGG No data
1035796321_1035796323 1 Left 1035796321 8:2360489-2360511 CCAGCCTAAACTTCAGATCTTTA No data
Right 1035796323 8:2360513-2360535 GAGAACAGAAATGCCAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035796321 Original CRISPR TAAAGATCTGAAGTTTAGGC TGG (reversed) Intergenic