ID: 1035796323

View in Genome Browser
Species Human (GRCh38)
Location 8:2360513-2360535
Sequence GAGAACAGAAATGCCAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035796321_1035796323 1 Left 1035796321 8:2360489-2360511 CCAGCCTAAACTTCAGATCTTTA No data
Right 1035796323 8:2360513-2360535 GAGAACAGAAATGCCAGTTCTGG No data
1035796320_1035796323 2 Left 1035796320 8:2360488-2360510 CCCAGCCTAAACTTCAGATCTTT No data
Right 1035796323 8:2360513-2360535 GAGAACAGAAATGCCAGTTCTGG No data
1035796322_1035796323 -3 Left 1035796322 8:2360493-2360515 CCTAAACTTCAGATCTTTAAGAG No data
Right 1035796323 8:2360513-2360535 GAGAACAGAAATGCCAGTTCTGG No data
1035796319_1035796323 10 Left 1035796319 8:2360480-2360502 CCACTGCGCCCAGCCTAAACTTC No data
Right 1035796323 8:2360513-2360535 GAGAACAGAAATGCCAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035796323 Original CRISPR GAGAACAGAAATGCCAGTTC TGG Intergenic