ID: 1035797933

View in Genome Browser
Species Human (GRCh38)
Location 8:2376431-2376453
Sequence TCAGGACTGCGAATTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035797933_1035797946 25 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797946 8:2376479-2376501 GGGAAGCTGGCAGGTCTGAGGGG No data
1035797933_1035797944 23 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797944 8:2376477-2376499 AGGGGAAGCTGGCAGGTCTGAGG No data
1035797933_1035797937 3 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797937 8:2376457-2376479 AATCCACAGTCCTCTGGTGAAGG No data
1035797933_1035797938 4 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797938 8:2376458-2376480 ATCCACAGTCCTCTGGTGAAGGG No data
1035797933_1035797939 5 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797939 8:2376459-2376481 TCCACAGTCCTCTGGTGAAGGGG No data
1035797933_1035797943 16 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG No data
1035797933_1035797945 24 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797945 8:2376478-2376500 GGGGAAGCTGGCAGGTCTGAGGG No data
1035797933_1035797936 -3 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797936 8:2376451-2376473 TGAGTCAATCCACAGTCCTCTGG No data
1035797933_1035797941 12 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797941 8:2376466-2376488 TCCTCTGGTGAAGGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035797933 Original CRISPR TCAGGACTGCGAATTCCTGG AGG (reversed) Intergenic
No off target data available for this crispr