ID: 1035797935

View in Genome Browser
Species Human (GRCh38)
Location 8:2376449-2376471
Sequence AGAGGACTGTGGATTGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035797935_1035797946 7 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797946 8:2376479-2376501 GGGAAGCTGGCAGGTCTGAGGGG No data
1035797935_1035797948 16 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797948 8:2376488-2376510 GCAGGTCTGAGGGGAGTGCTGGG No data
1035797935_1035797943 -2 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG No data
1035797935_1035797945 6 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797945 8:2376478-2376500 GGGGAAGCTGGCAGGTCTGAGGG No data
1035797935_1035797947 15 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797947 8:2376487-2376509 GGCAGGTCTGAGGGGAGTGCTGG No data
1035797935_1035797949 17 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797949 8:2376489-2376511 CAGGTCTGAGGGGAGTGCTGGGG No data
1035797935_1035797944 5 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797944 8:2376477-2376499 AGGGGAAGCTGGCAGGTCTGAGG No data
1035797935_1035797941 -6 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797941 8:2376466-2376488 TCCTCTGGTGAAGGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035797935 Original CRISPR AGAGGACTGTGGATTGACTC AGG (reversed) Intergenic
No off target data available for this crispr