ID: 1035797943

View in Genome Browser
Species Human (GRCh38)
Location 8:2376470-2376492
Sequence CTGGTGAAGGGGAAGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035797934_1035797943 13 Left 1035797934 8:2376434-2376456 CCAGGAATTCGCAGTCCTGAGTC No data
Right 1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG No data
1035797933_1035797943 16 Left 1035797933 8:2376431-2376453 CCTCCAGGAATTCGCAGTCCTGA No data
Right 1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG No data
1035797935_1035797943 -2 Left 1035797935 8:2376449-2376471 CCTGAGTCAATCCACAGTCCTCT No data
Right 1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035797943 Original CRISPR CTGGTGAAGGGGAAGCTGGC AGG Intergenic
No off target data available for this crispr