ID: 1035799772

View in Genome Browser
Species Human (GRCh38)
Location 8:2396242-2396264
Sequence CTGTGAAGTTACCATGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035799772_1035799775 10 Left 1035799772 8:2396242-2396264 CCTTTCACATGGTAACTTCACAG No data
Right 1035799775 8:2396275-2396297 CGACTGTGTGACGGAACCACAGG No data
1035799772_1035799773 1 Left 1035799772 8:2396242-2396264 CCTTTCACATGGTAACTTCACAG No data
Right 1035799773 8:2396266-2396288 ACATCCAGACGACTGTGTGACGG No data
1035799772_1035799777 28 Left 1035799772 8:2396242-2396264 CCTTTCACATGGTAACTTCACAG No data
Right 1035799777 8:2396293-2396315 ACAGGCGCCACCGCCTCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035799772 Original CRISPR CTGTGAAGTTACCATGTGAA AGG (reversed) Intergenic
No off target data available for this crispr