ID: 1035800588

View in Genome Browser
Species Human (GRCh38)
Location 8:2404332-2404354
Sequence GCCTCACGCCCTGTTCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035800584_1035800588 -8 Left 1035800584 8:2404317-2404339 CCCCTCATGACGGCAGCCTCACG No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800579_1035800588 21 Left 1035800579 8:2404288-2404310 CCAGCGTCAGAGGCTCACAGAGG No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800577_1035800588 29 Left 1035800577 8:2404280-2404302 CCACCACACCAGCGTCAGAGGCT No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800578_1035800588 26 Left 1035800578 8:2404283-2404305 CCACACCAGCGTCAGAGGCTCAC No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800585_1035800588 -9 Left 1035800585 8:2404318-2404340 CCCTCATGACGGCAGCCTCACGC No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800582_1035800588 -4 Left 1035800582 8:2404313-2404335 CCGCCCCCTCATGACGGCAGCCT No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800586_1035800588 -10 Left 1035800586 8:2404319-2404341 CCTCATGACGGCAGCCTCACGCC No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data
1035800583_1035800588 -7 Left 1035800583 8:2404316-2404338 CCCCCTCATGACGGCAGCCTCAC No data
Right 1035800588 8:2404332-2404354 GCCTCACGCCCTGTTCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035800588 Original CRISPR GCCTCACGCCCTGTTCCTCC GGG Intergenic
No off target data available for this crispr